G19756


Basic Information

Item Value
gene id G19756
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 12745990 ~ 12746308 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU22187
CATTTATTACTCACCTTCATGCCGTTCCACACCCATAAAACCTTCGTTAATCTTCGAAACACAAATTAAGATATTTTTGTTGAAATCCGATGGCTCAGTGAGGCCTACATAGCCAGCAATGACATTTCCTCTCTCAAGATCCATTAATGTACTAAAAACATATTTAAATCAGTTCATGTGAGTACAGTGGTTCAGTATTAATATTATAAAGCGACGAGAATGTTTTTGGTGCGCCAAAAAAACAAAATAACGACTTATATAGTGATGGCCGATTTCAAAACACTGCTTCAGGAAGCTTCGGAGCGTTATGAATCTTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU22187 True 319 lncRNA 0.33 1 12745990 12746308

Neighbor

gene id symbol gene type direction distance location
CI01000001_12718151_12726821 TBX18 coding upstream 18656 12717924 ~ 12727334 (+)
CI01000001_12657571_12666609 NA coding upstream 78611 12657571 ~ 12667379 (+)
CI01000001_12633655_12648702 NA coding upstream 96874 12633198 ~ 12649116 (+)
CI01000001_12602382_12613489 CABLES2A coding upstream 132052 12601961 ~ 12613938 (+)
CI01000001_12580225_12599311 NA coding upstream 146403 12579974 ~ 12599587 (+)
CI01000001_12814416_12815426 IRAK1BP1 coding downstream 68028 12814336 ~ 12815444 (+)
CI01000001_12873759_12874041 NA coding downstream 127451 12873448 ~ 12874215 (+)
CI01000001_12912442_12919516 SH3BGRL2 coding downstream 165306 12911614 ~ 12919991 (+)
CI01000001_12926362_12928572 RPS12, RGD1561102, RPS12-PS2, RPS12P4, GM4925, RPS12.S coding downstream 179106 12925414 ~ 12928579 (+)
CI01000001_12991367_12993048 NA coding downstream 244968 12991276 ~ 12993443 (+)
G19718 NA non-coding upstream 168065 12577514 ~ 12577925 (+)
G19717 NA non-coding upstream 168571 12577205 ~ 12577419 (+)
G19704 NA non-coding upstream 190526 12555099 ~ 12555464 (+)
G19702 NA non-coding upstream 193532 12552027 ~ 12552458 (+)
G19697 NA non-coding upstream 199610 12545950 ~ 12546380 (+)
G19783 NA non-coding downstream 53326 12799634 ~ 12810711 (+)
G19787 NA non-coding downstream 58993 12805301 ~ 12883428 (+)
G19792 NA non-coding downstream 75298 12821606 ~ 12826051 (+)
G19796 NA non-coding downstream 85600 12831908 ~ 12835161 (+)
G19395 NA other upstream 1064173 11681322 ~ 11681817 (+)
G19314 NA other upstream 1187317 11501194 ~ 11558673 (+)
G19039 NA other upstream 1892007 10850924 ~ 10853983 (+)
CI01000001_10538498_10539667 RPS26 other upstream 2206144 10538388 ~ 10539846 (+)
G18937 NA other upstream 2269601 10474984 ~ 10476389 (+)
CI01000001_13514115_13517063 NA other downstream 767096 13514115 ~ 13517063 (+)

Expression


Co-expression Network