G19697


Basic Information

Item Value
gene id G19697
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 12545950 ~ 12546380 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU22124
CACGGTGAACGTGATTTCACCAAGTACAACATGTTCCTGGATCAACAATCAGATTTGAGGGACAAGTTTACCATTTATGTCAAGTTTAGGCTTACAACCTGGGTTAGGTGCTTCCACAACAGTGTTATTCAACTATCATTTCCCTCTGATTTTAGGGATAAGTTATGGGTAGGGTTAGGTTTAGGGGTTGGGAAAAGGTTAGGACTAAATTTTCGGATAGGAATGTATATGTTGATCCAGGAACATGTCTTACTTGGCAAAATCACGGTGACCTGTCTTCACTGAGGAGAGGCTTTAGTCTGGCCACATTGCCATAAAGCAGATCAGTGGAGTGTTGCAGTGATGTTTGTCCTTCTGTACGTTTCTCCCATCTCCTTATGATCATGGAGCTCAACCAGAGTGACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU22124 True 405 lncRNA 0.56 2 12545950 12546380

Neighbor

gene id symbol gene type direction distance location
CI01000001_12503839_12514653 ASXL1 coding upstream 30622 12503528 ~ 12515328 (+)
CI01000001_12486765_12495297 DCJ11, DNAJC11A, DNAJC11 coding upstream 50432 12485546 ~ 12495518 (+)
CI01000001_12280407_12327837 NA coding upstream 217996 12278771 ~ 12327954 (+)
CI01000001_12088244_12091260 NA coding upstream 454456 12088167 ~ 12091494 (+)
CI01000001_12058281_12060612 NA coding upstream 484689 12057755 ~ 12061261 (+)
CI01000001_12556923_12557900 NPBWR2 coding downstream 9803 12556183 ~ 12558099 (+)
CI01000001_12568625_12571184 NA coding downstream 22154 12568534 ~ 12571943 (+)
CI01000001_12580225_12599311 NA coding downstream 33594 12579974 ~ 12599587 (+)
CI01000001_12602382_12613489 CABLES2A coding downstream 55581 12601961 ~ 12613938 (+)
CI01000001_12633655_12648702 NA coding downstream 86818 12633198 ~ 12649116 (+)
G19673 NA non-coding upstream 7396 12522673 ~ 12538554 (+)
G19538 NA non-coding upstream 64545 12109563 ~ 12481405 (+)
G19621 NA non-coding upstream 176920 12305013 ~ 12369030 (+)
G19548 NA non-coding upstream 401808 12143620 ~ 12144142 (+)
G19473 NA non-coding upstream 490352 12054928 ~ 12055598 (+)
G19702 NA non-coding downstream 5647 12552027 ~ 12552458 (+)
G19704 NA non-coding downstream 8719 12555099 ~ 12555464 (+)
G19717 NA non-coding downstream 30825 12577205 ~ 12577419 (+)
G19718 NA non-coding downstream 31134 12577514 ~ 12577925 (+)
G19756 NA non-coding downstream 199610 12745990 ~ 12746308 (+)
G19395 NA other upstream 864133 11681322 ~ 11681817 (+)
G19314 NA other upstream 987277 11501194 ~ 11558673 (+)
G19039 NA other upstream 1691967 10850924 ~ 10853983 (+)
CI01000001_10538498_10539667 RPS26 other upstream 2006104 10538388 ~ 10539846 (+)
G18937 NA other upstream 2069561 10474984 ~ 10476389 (+)
CI01000001_13514115_13517063 NA other downstream 967024 13514115 ~ 13517063 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
tiger barb (Puntius tetrazona) G190351 NA non-coding NW_025048446.1 JAEQBD010000791.1 859540 ~ 859852 (-)