G19924


Basic Information

Item Value
gene id G19924
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 13068772 ~ 13069012 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU22376
CCTCCCTTCGGAGCCTGGGCCGCAGGACCCCAAACACACCTCCAAGACGACCACTGCCTTGCTAAAGAAGCTGAGGGTAAAGGTGATGGACTGGCCAAGCATGTCTCCAGACCTAAACCCTATTGAGCATCTGTGGGGCATCCTCAAACGGAAGGTGGAGGAGCACAAGGTCTCTAACATCCACCAGCTCCGTGATGTCGTCATGGAGGAGTGGAAGAGGACTCCGGTGGCAACCTGTGAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU22376 True 241 lncRNA 0.34 1 13068772 13069012

Neighbor

gene id symbol gene type direction distance location
CI01000001_13011184_13014251 TBPL1 coding upstream 54510 13009419 ~ 13014262 (+)
CI01000001_13002416_13005974 NA coding upstream 62739 13002214 ~ 13006033 (+)
CI01000001_12991367_12993048 NA coding upstream 75329 12991276 ~ 12993443 (+)
CI01000001_12926362_12928572 RPS12, RGD1561102, RPS12-PS2, RPS12P4, GM4925, RPS12.S coding upstream 140193 12925414 ~ 12928579 (+)
CI01000001_12912442_12919516 SH3BGRL2 coding upstream 148781 12911614 ~ 12919991 (+)
CI01000001_13160253_13167224 MYB coding downstream 91241 13160253 ~ 13168505 (+)
CI01000001_13220895_13223877 ARMC1L coding downstream 151883 13220895 ~ 13224370 (+)
CI01000001_13235608_13240350 NA coding downstream 166596 13235608 ~ 13240441 (+)
CI01000001_13242387_13245977 NEMP1 coding downstream 173375 13242387 ~ 13246245 (+)
CI01000001_13266612_13285039 PAN2 coding downstream 197531 13266543 ~ 13285293 (+)
G19923 NA non-coding upstream 504 13068048 ~ 13068268 (+)
G19885 NA non-coding upstream 77647 12990593 ~ 12991125 (+)
G19910 NA non-coding upstream 78850 12988183 ~ 12989922 (+)
G19826 NA non-coding upstream 126468 12935747 ~ 12942304 (+)
G19825 NA non-coding upstream 138565 12929812 ~ 12930207 (+)
G19932 NA non-coding downstream 17309 13086321 ~ 13086557 (+)
G19935 NA non-coding downstream 22160 13091172 ~ 13091432 (+)
G19846 NA non-coding downstream 22832 13091844 ~ 13104246 (+)
G19952 NA non-coding downstream 102069 13171081 ~ 13171419 (+)
G19963 NA non-coding downstream 129148 13198160 ~ 13198366 (+)
G19395 NA other upstream 1386955 11681322 ~ 11681817 (+)
G19314 NA other upstream 1510099 11501194 ~ 11558673 (+)
G19039 NA other upstream 2214789 10850924 ~ 10853983 (+)
CI01000001_10538498_10539667 RPS26 other upstream 2528926 10538388 ~ 10539846 (+)
G18937 NA other upstream 2592383 10474984 ~ 10476389 (+)
CI01000001_13514115_13517063 NA other downstream 444392 13514115 ~ 13517063 (+)

Expression


Co-expression Network