G23542


Basic Information

Item Value
gene id G23542
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 1485538 ~ 1485753 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU26563
CAGGTTGCTTCAAGCTATGTTTCTTGTAGACCAATCATTGCTAGATTCGTTTGCTTTGTGTTGTTCATCGCTAAAGTTGTTGCTGGATGAATGATGATGAAGTGATCAAATACTCATTACCTCTGGTGACATATTGTAAGGCAGGGTGTTGGCCTTTCCCTGGAAGAACACTCATTGTGCACATTGTCACCATAATGCAAGTGTCCAATTAGAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU26563 True 216 lncRNA 0.33 1 1485538 1485753

Neighbor

gene id symbol gene type direction distance location
CI01000003_01424386_01424816 NA coding downstream 60623 1424350 ~ 1424915 (-)
CI01000003_01368353_01374263 YME1L1B, YME1L1 coding downstream 111275 1368353 ~ 1374263 (-)
CI01000003_01348419_01352984 RAB18B, RAB18, RAB18A coding downstream 132554 1346599 ~ 1352984 (-)
CI01000003_01200556_01220189 NA coding downstream 265349 1200052 ~ 1220189 (-)
CI01000003_01194276_01196374 BAMBIB coding downstream 288519 1193316 ~ 1197019 (-)
CI01000003_01601113_01624224 NA coding upstream 115212 1600965 ~ 1624224 (-)
CI01000003_01632757_01671893 EGFRA coding upstream 144854 1630607 ~ 1671893 (-)
CI01000003_01807697_01809455 C1QL3, C1QL3B coding upstream 321377 1807130 ~ 1809455 (-)
CI01000003_01836259_01849326 GPT2L, ALAT2 coding upstream 350447 1836200 ~ 1849326 (-)
CI01000003_01856167_01857447 FUZ coding upstream 369088 1854126 ~ 1857447 (-)
G23520 NA non-coding downstream 28692 1456634 ~ 1456846 (-)
G23479 NA non-coding downstream 32810 1450900 ~ 1452728 (-)
G23482 NA non-coding downstream 36147 1445231 ~ 1449391 (-)
G23481 NA non-coding downstream 63980 1416809 ~ 1421558 (-)
G23485 NA non-coding downstream 88702 1395449 ~ 1396836 (-)
G23553 NA non-coding upstream 11162 1496915 ~ 1498610 (-)
G23559 NA non-coding upstream 18778 1504531 ~ 1504957 (-)
G23566 NA non-coding upstream 22703 1508456 ~ 1508759 (-)
G23576 NA non-coding upstream 56352 1542105 ~ 1542477 (-)
G23577 NA non-coding upstream 57582 1543335 ~ 1543558 (-)
G22716 NA other downstream 1415794 50512 ~ 69744 (-)

Expression


Co-expression Network