LOC122350663 (tas2r202,LOC107696909,LOC107713025,LOC107552176,LOC107584865,LOC107714564)


Basic Information

Item Value
gene id LOC122350663
gene name tas2r202,LOC107696909,LOC107713025,LOC107552176,LOC107584865,LOC107714564
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056706.1
NCBI id CM032075.1
chromosome length 24299999
location 3575531 ~ 3576550 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043247345.1
CTCTCGTCTGGACCGCGATCGATCATGTTGTCGTCCTTGGACAAACTGGTGGCCTGGGTGCTGACCGGCTTCTTGGCGATCCTCACCATCTTCTTCAACATGTACCTGCTTCTGATCAACCAGAGGAACTACCGGAAGAGCGCCAAGCACCGCCTGAACCCGGCCGACTTCATCATCACGGCCATCTCCATTGCCAGCATCTCCCTGCAGGTTCTGACGTACCTATGGCAGACGCTGGATGTGATCGACACGGTGTGCCGCATCAGCCTGGCGGCGGCCATCCTGCTGGTGCTCATCTTCAGCGTCAAGTTCATCATCTTCTGGAGCACGGCGTTCCTGACCTTCTACTACGGCACTAAACTGGTGGTGGAGCCCGTGCACTGCTACACGCGCATCCAGGAGGCCATTGTCAAGCACGTCCACACGGCCCTGGCGGTGATCGCGGTGAGCGGCTTCGCCAACTGCGTCCCGCTGCTGAGCGTGCTGACCTACTACAACGGCACCAGCAGCGGGCTGAGCGACTGCGGCTCAATCATGCCCACCGACACCACCGGGCTCGCCTACGTCTTCTACTACGTGATCGTCTCCGACATCGTTCCGGGAATCGTGATGGTCAAATGCAGCATCTCCATCTCGTACCACCTGGCCAAGCACCTGCTGGACATGAAGGCCAGCAGCAACGGAGCCCACGGGCCCAAGCTCGGCACGCAGATGCGGGTCATCAAGATGACGCTCAGCCTGGTGGTGGTGTACGCAATCTTCCTGATCGTGGACATCTACACGCAGATGACTGTGGTGCTGATGAGGAACAACACGCTGGCCCTGACCATCCTCTTCGCCAGCATCTACACCGTGGTCAGCTCCTTCGTGCTGGTCTACGGGAAGAAAAGCTACTGGAAGGAGCTGATCGCATCCTATAACCTGTTTTTAGACGAGTACCCTTGTTTGAGCAGCTTAAAGGTGGAAGAGGTCAAAACAGAACCGCACGATCACAGCCACGGGCACAGCCACGGGCACTGA

Function

symbol description
tas2r202 Predicted to enable G protein-coupled receptor activity. Predicted to act upstream of or within G protein-coupled receptor signaling pathway and sensory perception of taste. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in taste bud. Orthologous to human TAS2R20 (taste 2 receptor member 20); TAS2R39 (taste 2 receptor member 39); and TAS2R40 (taste 2 receptor member 40).

NR:

description
PREDICTED: uncharacterized protein LOC107696909

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0050909 sensory perception of taste biological_process
GO:0016021 integral component of membrane cellular_component
GO:0004930 G protein-coupled receptor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043247345.1 True 1020 mRNA 0.58 1 3575531 3576550

Neighbor

gene id symbol gene type direction distance location
vsig8b LOC107696914,LOC107713026,LOC107552198,LOC107714559,LOC107584864,LOC107674302 coding upstream 6614 3555598 ~ 3568917 (+)
lrrtm4l2 lrrtm4l2,LOC107714548,LOC107674311,LOC107696910,LOC107584861,LOC107713015 coding upstream 49587 3497424 ~ 3525944 (+)
adra1aa adra1aa,LOC107553034,LOC107699645,LOC107552152,LOC107713032,LOC107671010,LOC108430341 coding upstream 541632 3015349 ~ 3033899 (+)
gatd3l es1,LOC107553036,LOC107671040,LOC107713034,LOC108430344 coding upstream 622847 2948990 ~ 2952684 (+)
LOC122350330 LOC107553039,LOC107714575,LOC107670999,LOC107552195 coding upstream 628182 2943281 ~ 2947349 (+)
nefmb nefmb,LOC107714570,LOC107674305,LOC107751590,LOC107552168,LOC107751596,LOC107696904 coding downstream 71452 3648002 ~ 3652067 (+)
asic1a asic1a,LOC107584862,LOC107751588,LOC107696918,LOC107674327,LOC107714557,LOC108439661 coding downstream 104983 3681533 ~ 3703724 (+)
gpd1a gpd1a,LOC107696907,LOC107751598,LOC107552204,LOC106571950,LOC106566713 coding downstream 128315 3704865 ~ 3711035 (+)
abtb1 abtb1,LOC107674366,LOC107696919,LOC107751593 coding downstream 150020 3726570 ~ 3737104 (+)
slc6a6a slc6a6a,LOC107696920,LOC107552205,LOC107714566,LOC108264963,LOC107674322 coding downstream 166935 3743485 ~ 3765088 (+)
G60718 NA non-coding upstream 5247 3569494 ~ 3570284 (+)
G60673 LOC107699615,LOC107552196 non-coding upstream 489158 3085756 ~ 3086373 (+)
G60668 bnip3la,LOC107552154,LOC107714550,LOC107699644,LOC107560275,LOC107671016 non-coding upstream 494808 3076876 ~ 3080723 (+)
G60661 NA non-coding upstream 517685 3056299 ~ 3057846 (+)
G60660 dpysl2a,LOC107552153,LOC107713031,LOC107671020,LOC108266046,LOC108430340,LOC107560268,LOC103154404 non-coding upstream 519512 3055427 ~ 3056019 (+)
G60728 NA non-coding downstream 2952 3579502 ~ 3579982 (+)
LOC122350949 NA non-coding downstream 30765 3607315 ~ 3607977 (+)
G60743 NA non-coding downstream 78211 3654761 ~ 3655932 (+)
G60782 NA non-coding downstream 248352 3824902 ~ 3826416 (+)
G60803 LOC107552212,LOC107701823,LOC107743103,LOC107674315,LOC107727414 non-coding downstream 308332 3884882 ~ 3885873 (+)
LOC122350758 dynll1,dynll2a,LOC103397138,LOC100698873,LOC107559583 other upstream 1535695 2037699 ~ 2039836 (+)
LOC122350053 NA other upstream 1539551 2030824 ~ 2035980 (+)
polb polb,LOC107670984,LOC107722860 other upstream 1555497 2014859 ~ 2020034 (+)
G60259 LOC107560031,LOC107559593,LOC108412499,LOC107754396 other upstream 1657160 1915460 ~ 1918371 (+)
pggt1b pggt1b other upstream 2356727 1210815 ~ 1218804 (+)
G60788 lhfpl4b,LOC107584928,LOC107674308,LOC107743140,LOC107727430,LOC107701811,LOC103032126,LOC105898894 other downstream 272064 3848614 ~ 3850557 (+)
LOC122350109 LOC107743114,LOC107552217,LOC107674346 other downstream 348311 3924861 ~ 3931488 (+)
ccdc120a LOC107701815,LOC107674368,LOC107584880,LOC107727423,LOC107552222 other downstream 452753 4029303 ~ 4073897 (+)
LOC122350082 si:ch211-240g9.1,LOC107598959,LOC107653411,LOC108438565,LOC108264952,LOC105013926,LOC100700110,LOC105889737 other downstream 1528020 5104570 ~ 5264366 (+)
LOC122350084 atp2a2,LOC107757297,LOC107674294,LOC107566800,LOC107599024,LOC108444117 other downstream 1650402 5226952 ~ 5229608 (+)

Expression


Co-expression Network