G34783


Basic Information

Item Value
gene id G34783
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15819749 ~ 15819958 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU39490
ATGCCACACAAGTGGAGTTTTGAGCCAGGGCGAGAACAGCTCCCTTCTGAACGCCAAAAGATCCTATTGACACAAGGCTTTCGGGAATTTCTCCTTGCCTTTCCCAGACTCTGAGACGGTGGTCCATGGCCCCAGACAGCAGCAGCTCTGCCCCTTCTTCCTCCATCCACATGAGGCAGAGCATGGACACCTGCAGCTCCTCACTGGCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU39490 True 210 lncRNA 0.58 1 15819749 15819958

Neighbor

gene id symbol gene type direction distance location
CI01000004_15760841_15761919 HBL4 coding downstream 57762 15760790 ~ 15761987 (-)
CI01000004_15751774_15753519 NA coding downstream 64352 15751733 ~ 15755397 (-)
CI01000004_15726420_15733105 NA coding downstream 86644 15726052 ~ 15733105 (-)
CI01000004_15702447_15708692 METTL17 coding downstream 111057 15702371 ~ 15708692 (-)
CI01000004_15653837_15673610 NFATC4 coding downstream 146139 15653725 ~ 15673610 (-)
CI01000004_15827737_15828938 NA coding upstream 7710 15827668 ~ 15828960 (-)
CI01000004_15832789_15836192 NA coding upstream 12626 15832573 ~ 15836231 (-)
CI01000004_15836936_15841048 NA coding upstream 16504 15836462 ~ 15841829 (-)
CI01000004_15881212_15881809 NA coding upstream 60905 15880140 ~ 15883692 (-)
CI01000004_15911104_15915972 NA coding upstream 90978 15910936 ~ 15916019 (-)
G34785 NA non-coding downstream 2377 15816835 ~ 15817372 (-)
G34784 NA non-coding downstream 5842 15813029 ~ 15813907 (-)
G34641 NA non-coding downstream 10144 15801003 ~ 15809605 (-)
G34779 NA non-coding downstream 23359 15796010 ~ 15796390 (-)
G34620 NA non-coding downstream 39135 15779676 ~ 15780614 (-)
G34786 NA non-coding upstream 2744 15822702 ~ 15823085 (-)
G34787 NA non-coding upstream 4853 15824811 ~ 15825101 (-)
G34790 NA non-coding upstream 22343 15842301 ~ 15842864 (-)
G34792 NA non-coding upstream 27009 15846967 ~ 15847928 (-)
G34633 NA other downstream 31852 15787386 ~ 15787897 (-)
G34718 NA other downstream 538100 15281016 ~ 15281649 (-)
CI01000004_15086759_15087492 NA other downstream 729391 15086671 ~ 15087575 (-)
G34668 NA other downstream 766974 15051176 ~ 15052775 (-)
G34632 NA other downstream 794528 15011361 ~ 15025221 (-)
G34796 NA other upstream 40655 15860613 ~ 15863748 (-)
G34934 NA other upstream 581787 16401745 ~ 16421506 (-)
G34982 NA other upstream 682767 16502725 ~ 16515974 (-)
G34995 NA other upstream 709484 16529442 ~ 16533008 (-)

Expression


Co-expression Network