G34786


Basic Information

Item Value
gene id G34786
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15822702 ~ 15823085 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU39493
CGCCATCACTGACCTTCTTCCAGTAAACCACTGAATTCTGATGCCATATCTCCAATCTGCCCATGTCATAACCACACACCATGAGTTCATCAGTATCAAGGAAGCACACAGCTCGGACACCGCCTTTCTGGCGAGGAGCAGCTTCTGCGGATGATTGTATATAATTATTAATGCCAATCAAATATATATTTTTGGATGTGCAGCTGTAGTTTCATAAGAAATTGCAATGTTGTCACCGCTTTTCATATCAGTTTAGATTCTGCTTTTGTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU39493 True 270 lncRNA 0.41 2 15822702 15823085

Neighbor

gene id symbol gene type direction distance location
CI01000004_15760841_15761919 HBL4 coding downstream 60715 15760790 ~ 15761987 (-)
CI01000004_15751774_15753519 NA coding downstream 67305 15751733 ~ 15755397 (-)
CI01000004_15726420_15733105 NA coding downstream 89597 15726052 ~ 15733105 (-)
CI01000004_15702447_15708692 METTL17 coding downstream 114010 15702371 ~ 15708692 (-)
CI01000004_15653837_15673610 NFATC4 coding downstream 149092 15653725 ~ 15673610 (-)
CI01000004_15827737_15828938 NA coding upstream 4583 15827668 ~ 15828960 (-)
CI01000004_15832789_15836192 NA coding upstream 9499 15832573 ~ 15836231 (-)
CI01000004_15836936_15841048 NA coding upstream 13377 15836462 ~ 15841829 (-)
CI01000004_15881212_15881809 NA coding upstream 57778 15880140 ~ 15883692 (-)
CI01000004_15911104_15915972 NA coding upstream 87851 15910936 ~ 15916019 (-)
G34783 NA non-coding downstream 2744 15819749 ~ 15819958 (-)
G34785 NA non-coding downstream 5330 15816835 ~ 15817372 (-)
G34784 NA non-coding downstream 8795 15813029 ~ 15813907 (-)
G34641 NA non-coding downstream 13097 15801003 ~ 15809605 (-)
G34779 NA non-coding downstream 26312 15796010 ~ 15796390 (-)
G34787 NA non-coding upstream 1726 15824811 ~ 15825101 (-)
G34790 NA non-coding upstream 19216 15842301 ~ 15842864 (-)
G34792 NA non-coding upstream 23882 15846967 ~ 15847928 (-)
G34793 NA non-coding upstream 26498 15849583 ~ 15849826 (-)
G34633 NA other downstream 34805 15787386 ~ 15787897 (-)
G34718 NA other downstream 541053 15281016 ~ 15281649 (-)
CI01000004_15086759_15087492 NA other downstream 732344 15086671 ~ 15087575 (-)
G34668 NA other downstream 769927 15051176 ~ 15052775 (-)
G34632 NA other downstream 797481 15011361 ~ 15025221 (-)
G34796 NA other upstream 37528 15860613 ~ 15863748 (-)
G34934 NA other upstream 578660 16401745 ~ 16421506 (-)
G34982 NA other upstream 679640 16502725 ~ 16515974 (-)
G34995 NA other upstream 706357 16529442 ~ 16533008 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
tiger barb (Puntius tetrazona) G13111 LOC107738210,LOC107591364 unknown NC_056700.1 CM032069.1 17607252 ~ 17608092 (+)