G34801



Basic Information


Item Value
gene id G34801
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15887137 ~ 15887413 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU39509
GACCCAGATGCTGCCGACGTGAGCCAACCCCGCAGTCTGCTTTTGTCGCCACTAGTTTGTCGATGTCAGCTAGCTGTATTCCTGCCTTTAGTCTGCTATGAGCGAGAGATGGAGAGGAGGAGCGCTAAAGTAAAACCCTGCCCTCTATTCAATATTCTGTTTCACTTGGAAATACGTCACAACACTGGAGAAAAGTCGTTTGCAACTTTCGGTTCACGGGGACTTTAGGCTAACATATTCATACTAAAAGCTAAAAAACTTAAATTTTGATTTCAGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU39509 True 277 lncRNA 0.45 1 15887137 15887413

Neighbor


gene id symbol gene type direction distance location
CI01000004_15881212_15881809 NA coding downstream 3445 15880140 ~ 15883692 (-)
CI01000004_15836936_15841048 NA coding downstream 46089 15836462 ~ 15841829 (-)
CI01000004_15832789_15836192 NA coding downstream 50933 15832573 ~ 15836231 (-)
CI01000004_15827737_15828938 NA coding downstream 58177 15827668 ~ 15828960 (-)
CI01000004_15760841_15761919 HBL4 coding downstream 125150 15760790 ~ 15761987 (-)
CI01000004_15911104_15915972 NA coding upstream 23523 15910936 ~ 15916019 (-)
CI01000004_15922924_15923872 NA coding upstream 35313 15922726 ~ 15923872 (-)
CI01000004_15956601_15962195 TOX4 coding upstream 68587 15956000 ~ 15962930 (-)
CI01000004_15965178_15990162 CHD8 coding upstream 77707 15965120 ~ 15990175 (-)
CI01000004_15991836_15995032 CBLN12, CBLN3, CBLN1 coding upstream 104227 15991640 ~ 15995184 (-)
G34799 NA non-coding downstream 9387 15877268 ~ 15877750 (-)
G34794 NA non-coding downstream 35269 15851264 ~ 15851868 (-)
G34793 NA non-coding downstream 37311 15849583 ~ 15849826 (-)
G34792 NA non-coding downstream 39209 15846967 ~ 15847928 (-)
G34616 NA non-coding upstream 19500 15906913 ~ 15910671 (-)
G34811 NA non-coding upstream 38597 15926010 ~ 15926261 (-)
G34814 NA non-coding upstream 41030 15928443 ~ 15928750 (-)
G34583 NA non-coding upstream 42962 15930375 ~ 15944664 (-)
G34830 NA non-coding upstream 111406 15998819 ~ 15999147 (-)
G34796 NA other downstream 23389 15860613 ~ 15863748 (-)
G34633 NA other downstream 99240 15787386 ~ 15787897 (-)
G34718 NA other downstream 605488 15281016 ~ 15281649 (-)
CI01000004_15086759_15087492 NA other downstream 796779 15086671 ~ 15087575 (-)
G34934 NA other upstream 514332 16401745 ~ 16421506 (-)
G34982 NA other upstream 615312 16502725 ~ 16515974 (-)
G34995 NA other upstream 642029 16529442 ~ 16533008 (-)
G34999 NA other upstream 649782 16537195 ~ 16541278 (-)
CI01000004_16596848_16599652 NA other upstream 691254 16596476 ~ 16601205 (-)

Expression



Co-expression Network