G34214


Basic Information

Item Value
gene id G34214
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15920683 ~ 15920886 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU38778
TCAGTGTTTCTTCTAGTTTTAGTATCCTTTCATCCATGTGTTTTAGCTTCTCGAGCTCAGCAATAATGTTCACAGCTGGTGACAACAATTGAGCTCCCAGCACAGAGCAGCAGCACCAGCAGCAGAACGGCCATTGTCTTGATTTTCATTTATTTTCAGACACTCAAATTACTCCTGTGATTATTCCACAATTCAGCTTTAAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU38778 True 204 lncRNA 0.49 1 15920683 15920886

Neighbor

gene id symbol gene type direction distance location
CI01000004_15906907_15909647 HNRNPC coding upstream 11014 15906907 ~ 15909669 (+)
CI01000004_15892502_15900203 DCAF8 coding upstream 19831 15890373 ~ 15900852 (+)
CI01000004_15867404_15875293 NA coding upstream 45379 15866985 ~ 15875304 (+)
CI01000004_15859240_15861471 APOL1 coding upstream 57234 15859240 ~ 15863449 (+)
CI01000004_15825817_15827475 TEP1 coding upstream 93080 15825817 ~ 15827603 (+)
CI01000004_15930478_15944692 NA coding downstream 9592 15930478 ~ 15944744 (+)
CI01000004_15947153_15953245 NA coding downstream 26267 15947153 ~ 15953870 (+)
CI01000004_16008731_16013012 NA coding downstream 87729 16008615 ~ 16013049 (+)
CI01000004_16017111_16024481 SALL2 coding downstream 96099 16016985 ~ 16024782 (+)
CI01000004_16037124_16044487 MMP14, MMP14A, MMP14B, MT1-MMP coding downstream 116238 16037124 ~ 16044563 (+)
G34213 NA non-coding upstream 33149 15887278 ~ 15887534 (+)
G34205 NA non-coding upstream 77281 15843132 ~ 15843402 (+)
G34196 NA non-coding upstream 140059 15779675 ~ 15780624 (+)
G34195 NA non-coding upstream 141185 15779166 ~ 15779498 (+)
G34194 NA non-coding upstream 143332 15777033 ~ 15777351 (+)
G34215 NA non-coding downstream 2818 15923704 ~ 15924496 (+)
G34216 NA non-coding downstream 7615 15928501 ~ 15928750 (+)
G34228 NA non-coding downstream 94020 16014906 ~ 16015106 (+)
G34229 NA non-coding downstream 98377 16019263 ~ 16019489 (+)
G33830 NA non-coding downstream 237826 16158712 ~ 16160998 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other upstream 828714 15091200 ~ 15097173 (+)
CI01000004_14036114_14036449 KIAA0040 other upstream 1883783 14035393 ~ 14039142 (+)
CI01000004_12646972_12652534 NA other upstream 3264972 12646838 ~ 12652570 (+)
G31865 NA other upstream 3725536 12192130 ~ 12197418 (+)
CI01000004_11666900_11667179 NA other upstream 4253024 11666900 ~ 11667659 (+)
G34220 NA other downstream 18471 15939357 ~ 15939950 (+)
G33815 NA other downstream 142529 16063415 ~ 16066464 (+)
G34400 NA other downstream 1056442 16971995 ~ 17025976 (+)

Expression


Co-expression Network