CI01000005_07593934_07596058 (RPS27A, DENND5B)


Basic Information

Item Value
gene id CI01000005_07593934_07596058
gene name RPS27A, DENND5B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 7593926 ~ 7596058 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000005_07593934_07596058.mRNA
ATGCAGATTTTCGTGAAAACGCTGACGGGTAAAACCATCACACTCGAGGTCGAGCCGTCAGATACTATTGAGAATGTCAAGGCAAAGATCCAGGACAAAGAAGGGATTCCTCCGGACCAGCAGAGGCTGATCTTTGCAGGGAAGCAGCTGGAGGACGGGCGCACACTGTCAGACTACAACATCCAGAAGGAGTCCACTCTGCACCTGGTGCTCCGGCTGCGCGGCGGAGCCAAGAAGAGGAAGAAGAAGTCCTACACCACCCCGAAGAAGAACAAGCACAAGAGGAAGAAGGTGAAGCTGGCCGTACTCAAGTACTACAAGGTGGATGAGAACGGGAAGATCCACCGTCTGCGGCGCGAGTGTCCGGCGGACGAGTGCGGCGCTGGAGTCTTCATGGCCAGTCACTTCGACAGGCATTACTGCGGGAAGTGCTGCCTGACCTACTGCTTCAACAAACCTGAGGATAAATAATCAATAAA

Function

symbol description
dennd5b Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in neural plate and tail bud. Orthologous to human DENND5B (DENN domain containing 5B).
rps27a Predicted to enable protein tag and ubiquitin protein ligase binding activity. Predicted to be a structural constituent of ribosome. Predicted to be involved in modification-dependent protein catabolic process and protein ubiquitination. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Predicted to be active in cytoplasm and nucleus. Orthologous to human RPS27A (ribosomal protein S27a).

GO:

id name namespace
GO:0022627 cytosolic small ribosomal subunit cellular_component

KEGG:

id description
K02977 RP-S27Ae, RPS27A, UBA80; ubiquitin-small subunit ribosomal protein S27Ae

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000005_07593934_07596058.mRNA True 479 mRNA 0.54 5 7593926 7596058

Neighbor

gene id symbol gene type direction distance location
CI01000005_07591912_07592984 NA coding downstream 935 7591912 ~ 7592991 (-)
CI01000005_07436839_07437813 NA coding downstream 155502 7436065 ~ 7438424 (-)
CI01000005_07398684_07399164 MPC1.S, MPC1, MPC1.L coding downstream 194762 7398487 ~ 7399164 (-)
CI01000005_07373961_07374634 NA coding downstream 219292 7373410 ~ 7374634 (-)
CI01000005_07355833_07360372 NA coding downstream 233554 7355833 ~ 7360372 (-)
CI01000005_07617632_07620944 NA coding upstream 21507 7617565 ~ 7620944 (-)
CI01000005_07622471_07624184 NA coding upstream 25282 7621340 ~ 7624184 (-)
G40586 NA non-coding downstream 109403 7484324 ~ 7484523 (-)
G40585 NA non-coding downstream 112204 7481523 ~ 7481722 (-)
G40580 NA non-coding downstream 125688 7458821 ~ 7468238 (-)
G40566 NA non-coding downstream 166014 7427699 ~ 7427912 (-)
G40564 NA non-coding downstream 167960 7425711 ~ 7425966 (-)
G40602 NA non-coding upstream 4487 7600545 ~ 7602965 (-)
G40604 NA non-coding upstream 9991 7606049 ~ 7606279 (-)
G40540 NA other downstream 61778 7526221 ~ 7532148 (-)
G40487 NA other downstream 397498 7195795 ~ 7196428 (-)
CI01000005_06481721_06483251 NA other downstream 1110437 6481355 ~ 6483265 (-)
G39515 NA other downstream 1759387 5833792 ~ 5834539 (-)
G38415 NA other downstream 3192816 4381238 ~ 4401110 (-)

Expression


Co-expression Network