G12414 (sik2b,LOC108436519,LOC108277697,LOC107657230,LOC107717286)



Basic Information


Item Value
gene id G12414
gene name sik2b,LOC108436519,LOC108277697,LOC107657230,LOC107717286
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_035898.1
NCBI id CM008301.1
chromosome length 34292151
location 21622628 ~ 21623561 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>TU16683
CCTGCACTAGTGAGGACTCCTGGTTGGTTGGTGACCTCTGAGAGGGTGTGTCTCCGCTGGCTAAAACGTGTCTGATAGGCGTTAAACATGTGGGCGTGATCCTCCTCTGCGTCAGGCTCCTCTGTCTCTATGCCCTCGTCAATCGACATCTCCATCATATTGCTGGGAGATGAAGTGCTGGATTTACGCACTGCCACAGGAGGGAGAGGATCCAGCATGCAGCCGTCCACCCTCGCTCTCTTTTT

Function


symbol description
sik2b Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in cellular response to glucose starvation; intracellular signal transduction; and protein phosphorylation. Predicted to be active in cytoplasm. Orthologous to human SIK2 (salt inducible kinase 2).

NR:

description
PREDICTED: serine/threonine-protein kinase SIK2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU16683 True 245 lncRNA 0.43 2 21622628 21623561

Neighbor


gene id symbol gene type direction distance location
LOC103031614 ppp2r1b,LOC104918016 coding upstream 25276 21574950 ~ 21597352 (+)
nkapd1 LOC103031305 coding upstream 73541 21544356 ~ 21549087 (+)
LOC103033418 ubash3bb,LOC108436514,LOC108278382,LOC107709118,LOC107586242,LOC107601707,LOC107677523 coding upstream 568773 20994106 ~ 21053855 (+)
LOC103030893 arcn1,LOC108436511,LOC108278096 coding upstream 662392 20951343 ~ 20960236 (+)
pih1d2 NA coding upstream 713821 20902276 ~ 20908807 (+)
LOC111194279 NA coding downstream 141397 21764958 ~ 21827382 (+)
ttc12 NA coding downstream 221204 21844765 ~ 21905395 (+)
LOC111194280 NA coding downstream 295657 21919218 ~ 21931304 (+)
ankk1 NA coding downstream 314828 21938389 ~ 21955844 (+)
LOC111194234 NA coding downstream 685791 22309352 ~ 22318452 (+)
G12410 NA non-coding upstream 9628 21610172 ~ 21613000 (+)
G12379 NA non-coding upstream 91090 21500197 ~ 21531538 (+)
G12373 LOC108436499,LOC108436498 non-coding upstream 103395 21483113 ~ 21519233 (+)
G12370 NA non-coding upstream 147593 21472615 ~ 21475035 (+)
G12369 NA non-coding upstream 150635 21471007 ~ 21471993 (+)
G12421 NA non-coding downstream 24791 21648352 ~ 21648643 (+)
G12424 NA non-coding downstream 56279 21679840 ~ 21716389 (+)
G12428 NA non-coding downstream 61796 21685357 ~ 21685942 (+)
G12445 NA non-coding downstream 118296 21741857 ~ 21742304 (+)
G12470 NA non-coding downstream 275909 21899470 ~ 21899720 (+)
G12362 bco2b,LOC108436497,LOC107586303,LOC107657247 other upstream 158979 21459850 ~ 21463649 (+)
LOC103033739 gkup,LOC108436512,LOC108278261,LOC106612544,LOC105024033,LOC107709108,LOC107717281,LOC107657260,LOC107586304 other upstream 632564 20963049 ~ 20990064 (+)
trnan-guu NA other upstream 646351 20976204 ~ 20976277 (+)
LOC103043893 picalmb,LOC108435293,LOC107726102,LOC107662770,LOC107597534,LOC107729110,LOC107699893,LOC108278317,LOC105903807 other upstream 2177797 19412807 ~ 19444831 (+)
LOC111194200 NA other upstream 4479280 17139425 ~ 17143348 (+)
spa17 spa17,LOC107709112,LOC107586300,LOC107657238,LOC107717271 other downstream 677435 22300996 ~ 22384972 (+)
oaf oaf,oafa,LOC107696006,LOC107709135,LOC107586231,LOC107657251,LOC107717291 other downstream 850091 22473652 ~ 22517780 (+)
G13067 NA other downstream 2230437 23853998 ~ 23855353 (+)
ccdc9 ccdc9,LOC107548566,LOC107664938 other downstream 3077281 24700842 ~ 24722676 (+)
G13237 NA other downstream 3232372 24855933 ~ 24857022 (+)

Expression



Co-expression Network