G130151 (clstn1)


Basic Information

Item Value
gene id G130151
gene name clstn1
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035911.1
NCBI id CM008314.1
chromosome length 35718434
location 7619566 ~ 7621237 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU176018
GGTCATCCTCTCCCTCGGCCTCAGCCTCCACCTCTCGGGTAATGGTGCTGACAATGCGAAGCTCAGGGAAGAGTGTCACACCCTCAGCGCTCTCAAAATCTGCAGCTCCGCGAGCGAAGTGGTCGATGCCGCTCAGGCTGATCTTCGGTTCCTCGGGCTGGAGGACCATCACGTAGCCTTCAGCATCAGGCACGGAGATGCAGGTCTCTTCATTGAAGCACTTGACAGTGGTGGTAACGCGAAGGTGGCGTATTCCTGGTGTGGGGAACTGTCTGGAGTTCAGATAAGAGATGTGCTGCATGACCTTCTCAAAGCTCTCAATATCATCTCCCTCCAGAGTCAGAGAAGACTGATTGGGGTTAAACTCCACCTGCACAGAGACACAAACAAGAGTAATGAGTCAGACTCAATGAGTCACCAGAGCTG

Function

symbol description
clstn1 Predicted to enable calcium ion binding activity. Acts upstream of or within several processes, including axon arborization; establishment or maintenance of microtubule cytoskeleton polarity; and homophilic cell adhesion via plasma membrane adhesion molecules. Predicted to be located in Golgi membrane; cell projection; and synapse. Predicted to be integral component of membrane. Predicted to be active in cell surface and postsynaptic membrane. Is expressed in several structures, including axis; musculature system; nervous system; neural tube; and tail bud. Orthologous to human CLSTN1 (calsyntenin 1).

NR:

description
calsyntenin-1 isoform X4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU176018 True 426 lncRNA 0.54 2 7619566 7621237

Neighbor

gene id symbol gene type direction distance location
pex14 pex14,LOC107681981,LOC107708844,LOC107586529,LOC107716227,LOC107695784 coding upstream 577532 6924949 ~ 7042034 (+)
masp2 masp2 coding upstream 725203 6850087 ~ 6894363 (+)
cort cort,sst3,LOC107708791,LOC107571809,LOC107695747 coding upstream 791837 6825920 ~ 6827729 (+)
srm srm coding upstream 802535 6810624 ~ 6817031 (+)
smc1a smc1a,LOC107586531,LOC107716226,LOC107695786 coding upstream 810198 6787909 ~ 6809368 (+)
aurkaip1 aurkaip1 coding downstream 297772 7919009 ~ 7922636 (+)
LOC103036256 mxra8 coding downstream 302626 7923863 ~ 7946663 (+)
LOC103035729 dvl1,dvl1a,LOC107708824,LOC107570850 coding downstream 328600 7949837 ~ 8019122 (+)
LOC103036568 NA coding downstream 410296 8031533 ~ 8038450 (+)
LOC107197257 NA coding downstream 883236 8504473 ~ 8514270 (+)
G130145 NA non-coding upstream 8319 7610818 ~ 7611247 (+)
G130140 NA non-coding upstream 32259 7587108 ~ 7587307 (+)
G130128 ube4b non-coding upstream 71072 7544430 ~ 7548494 (+)
G130101 pgd,LOC107586524 non-coding upstream 177698 7421156 ~ 7441868 (+)
G130100 NA non-coding upstream 198581 7420755 ~ 7420985 (+)
G130169 NA non-coding downstream 57229 7678466 ~ 7678826 (+)
G130174 NA non-coding downstream 88828 7710065 ~ 7710362 (+)
G130175 NA non-coding downstream 89770 7711007 ~ 7711370 (+)
G130179 NA non-coding downstream 96594 7717831 ~ 7718055 (+)
G130183 NA non-coding downstream 108139 7729376 ~ 7729647 (+)
lzic lzic,LOC107708836,LOC107681991,LOC107718820 other upstream 10683 7601605 ~ 7608883 (+)
G130120 LOC107716234,LOC107681965 other upstream 130325 7478355 ~ 7489241 (+)
G130119 NA other upstream 146608 7468385 ~ 7472958 (+)
tardbp tardbp,tardbpl,LOC107570713,LOC107586522,LOC107716231,LOC107681961,LOC107695779,LOC107708842 other upstream 204488 7408996 ~ 7415078 (+)
LOC103039794 RPS26,rps26l,rps26,LOC103039794,LOC108433306,LOC107708153,LOC100304574 other upstream 2018105 5599278 ~ 5601461 (+)
LOC103037383 LOC103037383,LOC108432529 other downstream 470494 8091731 ~ 8094054 (+)
G130413 NA other downstream 942413 8563650 ~ 8564575 (+)
cda LOC108416503,LOC108433378 other downstream 1041506 8662743 ~ 8665819 (+)
LOC103024807 LOC108435578,LOC107565318,LOC107701248 other downstream 1232452 8853689 ~ 8870829 (+)
G130518 pip4k2c,LOC107598997,LOC107664235,LOC107593957,LOC107714989 other downstream 1495933 9117170 ~ 9119782 (+)

Expression


Co-expression Network