CI01000012_12675446_12678283 (RAB1A, RAB1AB)


Basic Information

Item Value
gene id CI01000012_12675446_12678283
gene name RAB1A, RAB1AB
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 12675311 ~ 12678283 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000012_12675446_12678283.mRNA
TGACTATTTATTCAAGCTGCTCTTGATTGGTGACTCTGGTGTTGGAAAGTCTTGCCTTCTTCTCCGATTTGCAGATGACACATACACAGAAAGCTACATTAGCACTATTGGTGTGGACTTTAAAATAAGAACTATAGAATTAGACGGAAAGACCATCAAACTTCAAATCTGGGATACAGCAGGGCAAGAGAGGTTTCGCACAATCACATCCAGCTACTACAGAGGAGCACATGGCATTATTGTAGTCTATGATGTTACAGATCAGTGGCTACAGGAGATTGACCGCTATGCCAGTGAAAATGTTAACAAGTTATTGGTTGGCAACAAATGTGACTTAACAACAAAAAAAGTGGTGGACTACACAACAGCAAAGGAATTTGCAGATTCCCTTGGCATTCCTTTCTTGGAAACTAGCGCTAAGAATGCTACCAACGTGGAGCAGGCCTTCATGACCATGGCTGCTGAGATCAAGAAGAGAATGGGCCCCGGAGCCACAGCTGGAGGCGCTGAGAAGTCTAATGTGAAGATCCAGAGCACTCCGGTGAAGCCTGCATCTGGAGGCTGCTGCTGAGGCCCCCTCAACCCCGACCCCCGGCACCTCGGCCCCTGGATCTTGGAGCAAGAGTCCCCACAATAGGAGAAAGGAAGGGGAATAGATCATTTGTTATGGAGCAAAGAGTGAATATGGAGAAATAGAAAGAATAAA

Function

symbol description
rab1ab Predicted to enable GTPase activity. Predicted to be involved in autophagosome assembly and intracellular protein transport. Predicted to be active in endomembrane system. Is expressed in testis. Orthologous to human RAB1A (RAB1A, member RAS oncogene family).
rab1a Enables GTPase activity. Involved in several processes, including COPII-coated vesicle cargo loading; growth hormone secretion; and positive regulation of macromolecule metabolic process. Located in Golgi apparatus and extracellular exosome.

GO:

id name namespace
GO:0048208 COPII vesicle coating biological_process

KEGG:

id description
K07874 RAB1A; Ras-related protein Rab-1A

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000012_12675446_12678283.mRNA True 706 mRNA 0.46 5 12675311 12678283

Neighbor

gene id symbol gene type direction distance location
CI01000012_12613737_12614861 SERTAD2 coding downstream 59100 12611559 ~ 12616211 (-)
CI01000012_12598963_12604426 LGALSL coding downstream 69939 12597604 ~ 12605372 (-)
CI01000012_12592469_12594321 ECHS1 coding downstream 80110 12591958 ~ 12595201 (-)
CI01000012_12587953_12589094 FUOM coding downstream 85947 12587693 ~ 12589364 (-)
CI01000012_12540676_12541954 MSX3 coding downstream 132752 12540232 ~ 12542559 (-)
CI01000012_12681945_12685282 BRAFLDRAFT_86031 coding upstream 3543 12681826 ~ 12685282 (-)
CI01000012_12691707_12693855 PDCD2 coding upstream 13361 12691644 ~ 12693855 (-)
CI01000012_12741444_12744014 NA coding upstream 63031 12741314 ~ 12744434 (-)
CI01000012_12745876_12748041 ACTA2, ACTC1B, MGC64484, MGC53823, ACTC1, MGC75582, ACT3, ACTA1, ACTC1A, ACTC1.L, ACTA1B, ACT2, ACTA1A coding upstream 67298 12745581 ~ 12749149 (-)
CI01000012_12751670_12759821 ABCB10 coding upstream 72990 12751273 ~ 12759821 (-)
G76994 NA non-coding downstream 9660 12652366 ~ 12665651 (-)
G77014 NA non-coding downstream 610336 12064562 ~ 12064975 (-)
G76966 NA non-coding downstream 728782 11945062 ~ 11946529 (-)
G76956 NA non-coding downstream 770576 11904512 ~ 11904735 (-)
G76914 NA non-coding downstream 774930 11897330 ~ 11900381 (-)
G77128 NA non-coding upstream 27056 12705339 ~ 12705552 (-)
G77134 NA non-coding upstream 40663 12718946 ~ 12719187 (-)
G77149 NA non-coding upstream 102477 12780760 ~ 12781057 (-)
G76982 NA non-coding upstream 220072 12898355 ~ 12899359 (-)
G76975 NA non-coding upstream 222131 12900414 ~ 12901677 (-)
CI01000012_12079581_12084139 NA other downstream 591051 12078936 ~ 12084260 (-)
CI01000012_12047175_12052116 NA other downstream 623104 12046728 ~ 12052541 (-)
G75608 NA other downstream 2054440 10611915 ~ 10620871 (-)
G74982 NA other downstream 3099339 9575648 ~ 9576149 (-)
CI01000012_09400481_09401810 EIF4EBP2 other downstream 3273343 9398076 ~ 9402378 (-)
CI01000012_12954694_12954954 SF3B5, BRAFLDRAFT_284483 other upstream 276163 12954446 ~ 12957833 (-)
G77287 NA other upstream 940993 13619276 ~ 13633819 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
bowfin (Amia calva) AMCG00001644 rab1a,LOC107676578,LOC103035225,LOC107666439,LOC107601860,LOC105005759,LOC107725478 coding CM030143.1 CM030143.1 10709873 ~ 10717682 (+)