CI01000013_08098898_08099508 (UQCRFS1)


Basic Information

Item Value
gene id CI01000013_08098898_08099508
gene name UQCRFS1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 8098758 ~ 8099508 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000013_08098898_08099508.mRNA
GCCACTTTGGAGCACGTCTCATTCACACAGACATCAAAATCCCTGACTTCTCTGACTATCGGCGTGCTGAGGTGTTGGATCCTAAGACGTCCTCTCAGGAGAGCAGTGAAGCTAGGCGGGCCTTCTCTTACTTGGTGACCGGATCCACTGCTGTGTTGGGTGTCTATGCTGCCAAAACGGTTGTGACCCAGTTCATTTCCTCAATGAGTGCCTCTGCTGATGTCCTAGCCCTGTCCAAAATCGAGATCAAGCTGTCCGATATCCCAGAAGGGAAAAACATGACCTTCAAGTGGAGAGGCAAGCCTCTGTTTGTTCGTCACAGAACGGAGAAGGAGATCGCAGCTGAGCAGAACGTAGACCTCTCTGAGCTCCGAGACCCCCAGCATGACAAAGACCGCGTCGCCAACCCCACCTGGGTCATCGTTATTGGTGTCTGCACTCATCTCGGCTGCGTCCCAATCGCAAATGCCGGTGATTACGGCGGGTACTACTGCCCCTGCCATGGGTCACATTATGATGCTTCAGGAAGGATCAGAAAAGGACCCGCACCTCTCAACTTGGAGGTGCCTTATTATGAATTTCCTGATGAGGAAACTGTAATTGTTGGATAGGATATACAATGGACATTTTTCACTGTATGCTTTTAATCTGTCTGGCCAAATCTAACTATTAATAAATATATATTTTAAAGCATCCAATAATCTGTTTTTGAGGCTTTTGACTACGCATGCAAATATTGGTTACAAATAAA

Function

symbol description
uqcrfs1 Predicted to enable oxidoreductase activity. Predicted to be located in mitochondrion and respirasome. Predicted to be integral component of membrane. Predicted to be part of mitochondrial respiratory chain complex III. Is expressed in several structures, including alar plate midbrain region; axis; hatching gland; optic tectum; and polster. Human ortholog(s) of this gene implicated in mitochondrial complex III deficiency. Orthologous to several human genes including UQCRFS1 (ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1).

GO:

id name namespace
GO:0016020 membrane cellular_component

KEGG:

id description
K00411 UQCRFS1, RIP1, petA; ubiquinol-cytochrome c reductase iron-sulfur subunit

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000013_08098898_08099508.mRNA True 751 mRNA 0.48 1 8098758 8099508

Neighbor

gene id symbol gene type direction distance location
CI01000013_08090811_08094235 NA coding downstream 4454 8089673 ~ 8094304 (-)
CI01000013_08080409_08086491 TAT coding downstream 11204 8080360 ~ 8087554 (-)
CI01000013_08072726_08076570 NA coding downstream 21567 8072579 ~ 8077191 (-)
CI01000013_08059677_08060143 COTL1 coding downstream 38615 8058968 ~ 8060143 (-)
CI01000013_08042921_08047883 TLDC1 coding downstream 50298 8042210 ~ 8048460 (-)
CI01000013_08229647_08258878 TBXAS1 coding upstream 129664 8229172 ~ 8258878 (-)
CI01000013_08308180_08308362 NA coding upstream 208343 8307851 ~ 8309913 (-)
CI01000013_08311120_08328130 NA coding upstream 211477 8310985 ~ 8328343 (-)
CI01000013_08418098_08441411 NA coding upstream 318329 8417837 ~ 8441751 (-)
CI01000013_08555865_08573521 FGD4, FGD4A coding upstream 455700 8555208 ~ 8573521 (-)
G83465 NA non-coding downstream 19549 8078814 ~ 8079209 (-)
G83471 NA non-coding downstream 114156 7982184 ~ 7984602 (-)
G83477 NA non-coding downstream 124329 7972740 ~ 7974429 (-)
G83475 NA non-coding downstream 140702 7956962 ~ 7958056 (-)
G83211 NA non-coding downstream 198590 7868770 ~ 7900168 (-)
G83620 NA non-coding upstream 351331 8450839 ~ 8451904 (-)
G83658 NA non-coding upstream 385060 8484568 ~ 8484769 (-)
G83662 NA non-coding upstream 396535 8496043 ~ 8496249 (-)
G83663 NA non-coding upstream 396927 8496435 ~ 8496691 (-)
G83677 NA non-coding upstream 429644 8529152 ~ 8529368 (-)
CI01000013_07339918_07367774 NA other downstream 716398 7339709 ~ 7367774 (-)
CI01000013_05883498_05884071 CHTF8 other downstream 2214386 5882049 ~ 5884071 (-)
G81547 NA other downstream 2354720 5739526 ~ 5744038 (-)
G81032 NA other downstream 3348197 4748809 ~ 4750561 (-)
CI01000013_04561253_04567647 MAP2K1 other downstream 3539855 4560340 ~ 4567647 (-)
CI01000013_09309438_09335834 MICAL3A other upstream 1207528 9307036 ~ 9336077 (-)
G85170 NA other upstream 2380353 10479861 ~ 10480700 (-)
CI01000013_10564288_10569141 NA other upstream 2463951 10563459 ~ 10569290 (-)
G85188 NA other upstream 2492696 10592204 ~ 10595337 (-)
G85401 NA other upstream 2935524 11035032 ~ 11035466 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G188102 NA non-coding CI01000040 null 6649107 ~ 6649339 (+)
eurasian perch (Perca fluviatilis) G27075 LOC104939823,LOC100707594 unknown NC_053114.1 CM020911.1 13069996 ~ 13095766 (-)
mexican tetra (Astyanax mexicanus) G157540 LOC103039511,LOC100702099,LOC100707594,LOC105905159,LOC108412826,LOC105889141,LOC102291458 non-coding NC_035914.1 CM008317.1 10755079 ~ 10756662 (+)