G88833


Basic Information

Item Value
gene id G88833
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000015
NCBI id null
chromosome length 8631711
location 3287630 ~ 3302326 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU101139
CTGCCTGCCGCGCAGTGTCACGCTGCCGTCACTGTCGCCCTGACCGCATGTCTCGTTCACTCTCTCTGGCTCCAGTCCTCAGCTTTTTCTTCCTCTGGCCAGGGCCGGCGTCACCCGTTCGTCTCCAGCCTCCTTAAGTTTGCCATGTGCGCTGACCCACTCCTGACCCCCAGTCATGATACAAACTACTCCAAGGTCAGAGGGACAAGAAAAGGTTTCCTTAAGCTCTGGAGACCCAGAGGGAGAAGATGGAGATCATCACCTCGTTGGCAACCTGAGACAGAACAGAAGAACCACCCAGCCTCAGGAGACTAAAGTGCAAACTAGTCTACAAACCCTGCCAAATGCTGCGATTACATGAAAAGTCACAATAAATTATAAAATAAATGAAAGACTTCCTATTCTTCTGAGCAGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU101139 True 415 lncRNA 0.51 2 3287630 3302326

Neighbor

gene id symbol gene type direction distance location
CI01000015_03146304_03147242 SOX2, SOX2.L coding upstream 139891 3143611 ~ 3147739 (+)
CI01000015_03042640_03045708 NA coding upstream 241756 3041613 ~ 3045874 (+)
CI01000015_03011472_03026518 NA coding upstream 260994 3011472 ~ 3026636 (+)
CI01000015_02969241_02987416 TTC14 coding upstream 299935 2969241 ~ 2987695 (+)
CI01000015_02905712_02913298 HTR2B coding upstream 374040 2905437 ~ 2913590 (+)
CI01000015_03373445_03409681 ATP11B coding downstream 71119 3373445 ~ 3410965 (+)
CI01000015_03452576_03457978 NA coding downstream 149330 3451656 ~ 3458031 (+)
CI01000015_03460997_03462972 CART1 coding downstream 158671 3460997 ~ 3462998 (+)
CI01000015_03464878_03470145 NA coding downstream 160811 3463137 ~ 3470675 (+)
CI01000015_03482829_03494230 NA coding downstream 180503 3482829 ~ 3494230 (+)
G88783 NA non-coding upstream 34478 3252900 ~ 3253152 (+)
G88775 NA non-coding upstream 55224 3231932 ~ 3232406 (+)
G88769 NA non-coding upstream 68450 3218846 ~ 3219180 (+)
G88768 NA non-coding upstream 69608 3217774 ~ 3218022 (+)
G88749 NA non-coding upstream 99367 3188030 ~ 3188263 (+)
G88860 NA non-coding downstream 37521 3339847 ~ 3341600 (+)
G88866 NA non-coding downstream 147298 3449624 ~ 3449940 (+)
G88826 NA non-coding downstream 164581 3466907 ~ 3467408 (+)
CI01000015_03592958_03598421 NA non-coding downstream 281396 3586556 ~ 3600514 (+)
CI01000015_02512276_02523824 NA other upstream 771201 2511546 ~ 2524572 (+)
G88172 NA other upstream 787036 2384016 ~ 2526510 (+)
G87972 NA other upstream 1411036 1876004 ~ 1876594 (+)
G87432 NA other upstream 1676243 1611083 ~ 1611387 (+)
G89822 NA other downstream 989520 4291846 ~ 4314351 (+)
G90622 NA other downstream 1911970 5203697 ~ 5400121 (+)
CI01000015_05409997_05413784 NA other downstream 2106040 5409997 ~ 5413845 (+)
G90777 NA other downstream 2601768 5744146 ~ 5907461 (+)
CI01000015_06054566_06083712 NA other downstream 2761456 6054452 ~ 6083969 (+)

Expression


Co-expression Network