G127342



Basic Information


Item Value
gene id G127342
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 1569783 ~ 1569994 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU144682
GACATATCAATATGTAAACACATTCAAGGTTTTGCGGTTGCGACAATCACGCTGAGCAAGAAAATCTGTTTACTTTACTTACCTTTAAAATATATGGAGGTCCCTGCATCATTTCTCTCTCCATTTAGTGGTCTTTCGCCTGGAAAGGGTTGAAGAAGGGTTAAATCAGTGAATGTGACTTCAAGTCATCTTGAACACACTGGAAGTGAAGT

Function


NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU144682 True 212 lncRNA 0.39 1 1569783 1569994

Neighbor


gene id symbol gene type direction distance location
CI01000026_01452548_01454060 NA coding downstream 115723 1451839 ~ 1454060 (-)
CI01000026_01433833_01436599 GPHA2 coding downstream 133184 1433820 ~ 1436599 (-)
CI01000026_01384408_01386103 ARL2 coding downstream 183680 1384364 ~ 1386103 (-)
CI01000026_01341481_01348949 NA coding downstream 220834 1341133 ~ 1348949 (-)
CI01000026_01263538_01270706 ADAD2 coding downstream 299077 1263484 ~ 1270706 (-)
CI01000026_01660894_01664126 NA coding upstream 90517 1660511 ~ 1665349 (-)
CI01000026_01855346_01933699 DYSF coding upstream 284690 1854684 ~ 1933699 (-)
CI01000026_02124326_02125256 NA coding upstream 554122 2124116 ~ 2125256 (-)
CI01000026_02267615_02268297 NA coding upstream 697308 2267302 ~ 2268335 (-)
CI01000026_02272961_02276148 ACHE coding upstream 702256 2272250 ~ 2276786 (-)
G127294 NA non-coding downstream 50584 1471683 ~ 1519199 (-)
G127282 NA non-coding downstream 159237 1408930 ~ 1410546 (-)
G127279 NA non-coding downstream 168855 1399306 ~ 1400928 (-)
G127278 NA non-coding downstream 176175 1393407 ~ 1393608 (-)
G127275 NA non-coding downstream 181587 1387979 ~ 1388196 (-)
G127343 NA non-coding upstream 880 1570874 ~ 1571089 (-)
G127349 NA non-coding upstream 2775 1572769 ~ 1573045 (-)
G127350 NA non-coding upstream 3772 1573766 ~ 1573972 (-)
G127352 NA non-coding upstream 5795 1575789 ~ 1576024 (-)
G127353 NA non-coding upstream 7680 1577674 ~ 1577885 (-)
CI01000026_00986386_01002180 NA other downstream 567194 986182 ~ 1002180 (-)
G127418 NA other upstream 165783 1735777 ~ 1736220 (-)
CI01000026_03439507_03490314 PDE3B other upstream 1810791 3438795 ~ 3490503 (-)
G129476 NA other upstream 2100580 3670574 ~ 3670884 (-)
G129658 NA other upstream 2797302 4367296 ~ 4373069 (-)
G129750 NA other upstream 3243056 4785885 ~ 4820249 (-)

Expression



Co-expression Network