G128199


Basic Information

Item Value
gene id G128199
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 4548934 ~ 4549177 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU145658
CTCCACTTTTTTTGAAAATAGGCTCATTTTCCAACTCCCCTAGAGTTAAACAGTTGAGTTTTACCGTTTTCGAATCCATTCAGCCCATCTCCGGGTCTGGCGGTACCACTTTTAGCATAGCTTAGCATAGTTCATTGAATCTGATTAGACCGTTAGCATCTCGTTGAAAAATGACCAAAGAGTTTCAATATTTTTCCTATTTAAAACTTGACTCTTCTGTAGTTACATCATGTACTAAGACCGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU145658 True 244 lncRNA 0.38 1 4548934 4549177

Neighbor

gene id symbol gene type direction distance location
CI01000026_04503901_04507434 RAB8B coding upstream 40241 4503901 ~ 4508693 (+)
CI01000026_04497986_04501262 NA coding upstream 47235 4497926 ~ 4501699 (+)
CI01000026_04424762_04428710 APH1B coding upstream 120224 4424762 ~ 4428710 (+)
CI01000026_04418614_04423755 NA coding upstream 124619 4418075 ~ 4424315 (+)
CI01000026_04414146_04416156 TMPPE coding upstream 132247 4413230 ~ 4416687 (+)
CI01000026_04556074_04556964 FOXB1B, FOXB1, FOXB1A coding downstream 6778 4555776 ~ 4557613 (+)
CI01000026_04593208_04599259 ITLN4 coding downstream 43953 4593130 ~ 4599537 (+)
CI01000026_04773209_04807191 TLN2A, TLN2 coding downstream 222682 4771859 ~ 4807562 (+)
CI01000026_04812926_04818639 TPM1.L, XTM4, TPMA, TPM1-2, TPM1 coding downstream 263749 4812926 ~ 4819164 (+)
CI01000026_04820538_04825963 FBXO22 coding downstream 270955 4820132 ~ 4826429 (+)
G128193 NA non-coding upstream 32187 4516520 ~ 4516747 (+)
G128192 NA non-coding upstream 33323 4515347 ~ 4515611 (+)
G128129 NA non-coding upstream 71159 4473678 ~ 4477775 (+)
G128115 NA non-coding upstream 82816 4462197 ~ 4466118 (+)
G128125 NA non-coding upstream 93700 4453203 ~ 4455234 (+)
G128213 NA non-coding downstream 43219 4592396 ~ 4592772 (+)
G128218 NA non-coding downstream 76207 4625384 ~ 4627464 (+)
G128219 NA non-coding downstream 82657 4631834 ~ 4632069 (+)
G128222 NA non-coding downstream 92201 4641378 ~ 4642948 (+)
G128223 NA non-coding downstream 94720 4643897 ~ 4646900 (+)
G128137 NA other upstream 117733 4430562 ~ 4431201 (+)
CI01000026_04327206_04331151 DOK4, DOK5 other upstream 216849 4327206 ~ 4332085 (+)
G127979 NA other upstream 785948 3752551 ~ 3762986 (+)
CI01000026_02659356_02660297 NA other upstream 1888105 2658605 ~ 2660829 (+)
G127519 NA other upstream 2121928 2393683 ~ 2427006 (+)
G128585 NA other downstream 1400636 5949813 ~ 5950122 (+)
G128601 NA other downstream 1434702 5983879 ~ 5991761 (+)
G128757 NA other downstream 1777019 6326196 ~ 6326785 (+)
G130552 NA other downstream 2545876 7095053 ~ 7096652 (+)

Expression


Co-expression Network