CI01000026_04327206_04331151 (DOK4, DOK5)


Basic Information

Item Value
gene id CI01000026_04327206_04331151
gene name DOK4, DOK5
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 4327206 ~ 4332085 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000026_04327206_04331151.mRNA
GAAATTGGACACGCTGTAAGATGCATGAAACTTCATAAGATCTATCGGCGCTGCTGGCTGGTGTTTAAGAAGTCGTCCAGTAAAGGACCTCGCAGACTGGAAAAATACCCTGATGAAAAGTCAGCCTACATCAGAGCCTGTCCTAAGGTGACAGAGATTAGTAATGTGAAGAACATCACAAGATTGCCTCGTGACACGAAGCGGCAAGCTGTGGCCATCGTCTTTACAGATGACACCTCTCGAACCTTCACCTGTGAATCAGAGCTGGAGGCTGAAGAGTGGTTTAAAACCTTGTCTATTGAGTGCCTGGGGACACGTCTTAATGACATCAGTCTTGGAGAACCAGACCTCCTTGCTGCTGGAGTTCAGTGTGAACACACAG

Function

symbol description
dok4 Orthologous to human DOK4 (docking protein 4).
dok5 Acts upstream of or within regulation of neurotrophin TRK receptor signaling pathway. Predicted to be located in cytosol. Predicted to be active in cytoplasm.

GO:

id name namespace
GO:0007399 nervous system development biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000026_04327206_04331151.mRNA False 382 mRNA 0.48 4 4327206 4331151

Neighbor

gene id symbol gene type direction distance location
CI01000026_04209762_04249320 CCDC102A coding upstream 76909 4209392 ~ 4250297 (+)
CI01000026_04172127_04176264 NA coding upstream 150778 4171889 ~ 4176428 (+)
CI01000026_04062224_04065987 SLC7A6OS coding upstream 260778 4062224 ~ 4066428 (+)
CI01000026_03725294_03727306 NA coding upstream 599795 3725294 ~ 3727411 (+)
CI01000026_03664983_03686916 TUB coding upstream 639860 3664983 ~ 3687346 (+)
CI01000026_04333601_04341386 NA coding downstream 2450 4333601 ~ 4341491 (+)
CI01000026_04344703_04357534 GFOD2, COG4 coding downstream 13552 4344703 ~ 4357660 (+)
CI01000026_04361551_04365574 GFOD2 coding downstream 29910 4361061 ~ 4366072 (+)
CI01000026_04367338_04389547 NA coding downstream 35990 4367141 ~ 4389639 (+)
CI01000026_04390431_04394954 OGFOD1 coding downstream 58845 4389996 ~ 4395221 (+)
G128175 NA non-coding upstream 43595 4283412 ~ 4283611 (+)
G128162 NA non-coding upstream 55760 4271179 ~ 4271446 (+)
G128156 NA non-coding upstream 66916 4260063 ~ 4260290 (+)
G128084 NA non-coding upstream 163190 4140151 ~ 4164016 (+)
G128079 NA non-coding upstream 167317 4132956 ~ 4159889 (+)
CI01000026_04412437_04412814 NA non-coding downstream 81198 4412204 ~ 4412878 (+)
G128117 NA non-coding downstream 100944 4432095 ~ 4439272 (+)
G128125 NA non-coding downstream 122052 4453203 ~ 4455234 (+)
G128115 NA non-coding downstream 131046 4462197 ~ 4466118 (+)
G128129 NA non-coding downstream 142527 4473678 ~ 4477775 (+)
G127979 NA other upstream 564220 3752551 ~ 3762986 (+)
CI01000026_02659356_02660297 NA other upstream 1666377 2658605 ~ 2660829 (+)
G127519 NA other upstream 1900200 2393683 ~ 2427006 (+)
G127531 NA other upstream 2015071 2309322 ~ 2312135 (+)
G127500 NA other upstream 2380767 1931183 ~ 1946439 (+)
G128137 NA other downstream 99411 4430562 ~ 4431201 (+)
CI01000026_04556074_04556964 FOXB1B, FOXB1, FOXB1A other downstream 224625 4555776 ~ 4557613 (+)
G128585 NA other downstream 1618662 5949813 ~ 5950122 (+)
G128601 NA other downstream 1652728 5983879 ~ 5991761 (+)
G128757 NA other downstream 1995045 6326196 ~ 6326785 (+)

Expression


Co-expression Network