G131025


Basic Information

Item Value
gene id G131025
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 8241875 ~ 8242082 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU148995
CTGACTTGAAGCAGTGCATGCCGGTAAGAAATTTTGTCCGACTTAAGACAGCGCCGACGCCATGTGACTGTGATGTATGGCTTCAAAGTACTGTGAGAGCAATTCGAGATCGGCGGGGTACATGAGCTCTGAGAAAATATCTCCTTTTGCTTTGAACTTTGAGCGTCCTAACTACATGGAATTACCACAGTTGATAACTTGTTTTGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU148995 True 208 lncRNA 0.45 1 8241875 8242082

Neighbor

gene id symbol gene type direction distance location
CI01000026_08107438_08129873 ESRP2 coding upstream 111395 8107438 ~ 8130480 (+)
CI01000026_08103907_08104974 NA coding upstream 136276 8103814 ~ 8105599 (+)
CI01000026_08096241_08097257 NA coding upstream 144271 8095563 ~ 8097604 (+)
CI01000026_08031599_08081760 PLEKHG4 coding upstream 159970 8031599 ~ 8081905 (+)
CI01000026_07965621_07990576 SLC9A5 coding upstream 251232 7965576 ~ 7990643 (+)
CI01000026_08248451_08250136 DDX28 coding downstream 6289 8248371 ~ 8250221 (+)
CI01000026_08297901_08307596 CTRB1 coding downstream 55775 8297857 ~ 8307629 (+)
CI01000026_08313929_08318869 ATP6V0D1, ATP6V0D1.L coding downstream 69713 8311795 ~ 8318891 (+)
CI01000026_08421799_08434134 ZDHHC1 coding downstream 179601 8421683 ~ 8434193 (+)
CI01000026_08447474_08449558 TPPP3 coding downstream 205314 8447396 ~ 8450611 (+)
G130994 NA non-coding upstream 23523 8217683 ~ 8218352 (+)
G130993 NA non-coding upstream 24559 8216950 ~ 8217316 (+)
G130986 NA non-coding upstream 37913 8202841 ~ 8203962 (+)
G130962 NA non-coding upstream 65857 8175261 ~ 8176018 (+)
G130894 NA non-coding upstream 315743 7922174 ~ 7926132 (+)
G131028 NA non-coding downstream 2817 8244899 ~ 8245152 (+)
G131007 NA non-coding downstream 52525 8294607 ~ 8297170 (+)
G131046 NA non-coding downstream 67484 8309566 ~ 8309774 (+)
G131048 NA non-coding downstream 69451 8311533 ~ 8311749 (+)
G130967 NA other upstream 52802 8188374 ~ 8189073 (+)
G130552 NA other upstream 1145223 7095053 ~ 7096652 (+)
G128757 NA other upstream 1915090 6326196 ~ 6326785 (+)
G128601 NA other upstream 2250114 5983879 ~ 5991761 (+)
G128585 NA other upstream 2291753 5949813 ~ 5950122 (+)
G131077 NA other downstream 259326 8501408 ~ 8506787 (+)
G132667 NA other downstream 1326657 9568739 ~ 9569160 (+)
G133192 NA other downstream 1917737 10159819 ~ 10161961 (+)
CI01000026_11075931_11078249 MDK, MDKA other downstream 2828686 11075784 ~ 11079080 (+)

Expression


Co-expression Network