G160711


Basic Information

Item Value
gene id G160711
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 5450566 ~ 5477650 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU182439
TCTGGTTTCCCTCACAATCCAAAAATGTGTGAATTACAGATGTTTTTTTGTTTTTTTAAACCTTGTACAAAGGTTCCATGAATGTCTATATCGGACGTGCAAAAAACGTCAAAAAAAGACGACAAAAACTTTCATTCTGGCTCCTCAGTGGACGTTATTTCAACGTACAACTTTTGTGACCAAGACATTGAAAAGGCATCTTCCAGACATAACTTTGTTTAGTGGGTAAGACCACAGATGGTCAGCCAGACATAAATTGAAAAAAAGCTGGAGTAAAACACAGAGATCTGCTGATCCCACAGATGTGAATGAAGATGGACAGACATGCTGCTGCAGCAACACACACACACACACACACACACACACACACACACACATCCACACACACTTGCCTGATGCCTCAATATACTTGCTCATGTTACAGTTATATGGCATTGTGTTAACACTGCTTCAGAATAAAGCTTAACATTCAAACTATTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU182439 True 480 lncRNA 0.39 3 5450566 5477650

Neighbor

gene id symbol gene type direction distance location
CI01000030_05357534_05377672 CRB1 coding downstream 72894 5357466 ~ 5377672 (-)
CI01000030_05261553_05285669 NA coding downstream 164455 5261296 ~ 5286111 (-)
CI01000030_05233712_05242487 LHX9 coding downstream 208079 5233466 ~ 5242487 (-)
CI01000030_05165181_05189898 NEK7 coding downstream 260526 5164955 ~ 5190040 (-)
CI01000030_05080350_05087998 NA coding downstream 362568 5080350 ~ 5087998 (-)
CI01000030_05519604_05542781 NA coding upstream 41896 5519546 ~ 5542807 (-)
CI01000030_05561747_05564633 NA coding upstream 84097 5561747 ~ 5564710 (-)
CI01000030_05784109_05788689 NA coding upstream 306166 5783816 ~ 5788689 (-)
CI01000030_05791222_05793350 NA coding upstream 313403 5791053 ~ 5793350 (-)
CI01000030_05801355_05807277 NA coding upstream 323671 5801321 ~ 5807277 (-)
G160723 NA non-coding downstream 43773 5403227 ~ 5406793 (-)
G160613 NA non-coding downstream 306303 5143683 ~ 5144263 (-)
G160602 NA non-coding downstream 307346 5142670 ~ 5143220 (-)
G160706 NA non-coding downstream 320556 5129016 ~ 5130010 (-)
G160784 NA non-coding upstream 75395 5553045 ~ 5553284 (-)
G160732 NA non-coding upstream 78302 5555952 ~ 5556463 (-)
G160789 NA non-coding upstream 120757 5598407 ~ 5598608 (-)
G160806 NA non-coding upstream 171769 5649419 ~ 5649871 (-)
G160824 NA non-coding upstream 183773 5661423 ~ 5662944 (-)
G160713 NA other downstream 27053 5419119 ~ 5423513 (-)
CI01000030_03491770_03493119 CELF5A other downstream 1957466 3490119 ~ 3493741 (-)
G160213 NA other downstream 1981404 3466353 ~ 3469162 (-)
G158980 NA other downstream 2918002 2499584 ~ 2536375 (-)
G158914 NA other downstream 2998848 2450849 ~ 2451718 (-)
G160949 NA other upstream 319647 5797297 ~ 5800426 (-)
CI01000030_06131710_06138371 NA other upstream 655725 6131090 ~ 6138406 (-)
CI01000030_06701334_06704398 MGC53794, FAM195A, FAM195A.S, MCRIP2 other upstream 1223405 6701055 ~ 6704745 (-)
CI01000030_06747047_06752255 NA other upstream 1265608 6746960 ~ 6752411 (-)
G163065 NA other upstream 1446833 6924483 ~ 6925657 (-)

Expression


Co-expression Network