G160732


Basic Information

Item Value
gene id G160732
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 5555952 ~ 5556463 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU182463
CCTGGCAAGGTCTAACAGTGTATTTATGCATTTATATATGCAAAACATAATCTCAGCAAAAAAGGAGATGTTAATGTGAAAAACACCAAGAGAAAGATGTCCAGGATCCCCAGTCACCTGTGTGAACATGGCTTTATCCTGCTGCAGGAGTCATGAGGACTGCAGATGTGAACAGAGCAATAAACTGCAATGTCTGTAATGTAAGACACCTAAGACAGCACTACAGGGAGACAGAAAGAACAGCTGATCGCCCTCGCAGTGCCACATGTAGCCATATGTCCCACCAGACATGAAGTAGAGTAACATCTCACAACAAGAACTGGCAAATCTGGTGCAGTCCATGAGGATGAGATGAACTGTAGTACGTAAAGCAGCTGGTGGCCACAACATATACTGACTGCTATGTTGATATTGCCAGCCTGAGTTTCCCAGTCATAAATACAACTTGAGCGGCTGTTCATGTCCAATTTCCAGTATTTGAAACCAATATTTAAACTACTCAATAAAAGAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU182463 True 512 lncRNA 0.42 1 5555952 5556463

Neighbor

gene id symbol gene type direction distance location
CI01000030_05519604_05542781 NA coding downstream 13145 5519546 ~ 5542807 (-)
CI01000030_05477128_05482150 NA coding downstream 73802 5477128 ~ 5482150 (-)
CI01000030_05357534_05377672 CRB1 coding downstream 178280 5357466 ~ 5377672 (-)
CI01000030_05261553_05285669 NA coding downstream 269841 5261296 ~ 5286111 (-)
CI01000030_05233712_05242487 LHX9 coding downstream 313465 5233466 ~ 5242487 (-)
CI01000030_05561747_05564633 NA coding upstream 5284 5561747 ~ 5564710 (-)
CI01000030_05784109_05788689 NA coding upstream 227353 5783816 ~ 5788689 (-)
CI01000030_05791222_05793350 NA coding upstream 234590 5791053 ~ 5793350 (-)
CI01000030_05801355_05807277 NA coding upstream 244858 5801321 ~ 5807277 (-)
CI01000030_05996557_05996952 NA coding upstream 439563 5996026 ~ 5997542 (-)
G160784 NA non-coding downstream 2668 5553045 ~ 5553284 (-)
G160710 NA non-coding downstream 35999 5416321 ~ 5519953 (-)
G160711 NA non-coding downstream 78302 5450566 ~ 5477650 (-)
G160735 NA non-coding downstream 79060 5473564 ~ 5476892 (-)
G160723 NA non-coding downstream 149159 5403227 ~ 5406793 (-)
G160789 NA non-coding upstream 41944 5598407 ~ 5598608 (-)
G160806 NA non-coding upstream 92956 5649419 ~ 5649871 (-)
G160824 NA non-coding upstream 104960 5661423 ~ 5662944 (-)
G160833 NA non-coding upstream 120619 5677082 ~ 5677284 (-)
G160940 NA non-coding upstream 125411 5681874 ~ 5682395 (-)
G160712 NA other downstream 43878 5456960 ~ 5512074 (-)
G160713 NA other downstream 132439 5419119 ~ 5423513 (-)
CI01000030_03491770_03493119 CELF5A other downstream 2062852 3490119 ~ 3493741 (-)
G160213 NA other downstream 2086790 3466353 ~ 3469162 (-)
G158980 NA other downstream 3023388 2499584 ~ 2536375 (-)
G160949 NA other upstream 240834 5797297 ~ 5800426 (-)
CI01000030_06131710_06138371 NA other upstream 576912 6131090 ~ 6138406 (-)
CI01000030_06701334_06704398 MGC53794, FAM195A, FAM195A.S, MCRIP2 other upstream 1144592 6701055 ~ 6704745 (-)
CI01000030_06747047_06752255 NA other upstream 1186795 6746960 ~ 6752411 (-)
G163065 NA other upstream 1368020 6924483 ~ 6925657 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) G1785450 NA non-coding NC_048586.1 CM023240.2 19345337 ~ 19349418 (+)
bowfin (Amia calva) G107408 NA non-coding CM030133.1 CM030133.1 27883095 ~ 27883396 (+)