G170274


Basic Information

Item Value
gene id G170274
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 3257790 ~ 3258069 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU193453
CTCTGGAAGCAGTGAGCAGCAGACAAAACCCAGTCTTTATTAATCAGACTCCCGCCACAAAAATGGCCTCCAAAACTGACACTTTGAATGCTGACTTGCCACGGCCAGGACCCTGCTGCTGCATTTTCTCCTCCAACAATCTTGTTGTTGAGGGGAGCATGACCACATACTGATTACAGGAAAGAAAATGTTTGAATTCTAAATTAAAATGCCCTATAAGTAAACAAATGTAGAAAAAGAGTTTTATGGTCATTAAGACTATGACAACTTACCATCTAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU193453 True 280 lncRNA 0.41 1 3257790 3258069

Neighbor

gene id symbol gene type direction distance location
CI01000034_03235135_03236084 TCAP coding upstream 21200 3234926 ~ 3236590 (+)
CI01000034_03214677_03229150 SYNGR1, SYNGR1A coding upstream 27922 3214215 ~ 3229868 (+)
CI01000034_03195900_03212503 FAM171A2 coding upstream 45105 3195308 ~ 3212685 (+)
CI01000034_03151977_03170691 NA coding upstream 87052 3151382 ~ 3170738 (+)
CI01000034_03145811_03149071 NA coding upstream 108719 3145625 ~ 3149071 (+)
CI01000034_03273191_03285382 NA coding downstream 14351 3272420 ~ 3294805 (+)
CI01000034_03312399_03327633 TAOK2A, TAOK2, TAOK2B, TAOK2.L coding downstream 54330 3312399 ~ 3328593 (+)
CI01000034_03331693_03336338 CDIPT coding downstream 73624 3331693 ~ 3337116 (+)
CI01000034_03343690_03351003 NA coding downstream 85621 3343690 ~ 3351118 (+)
CI01000034_03358125_03363411 NA coding downstream 97640 3355709 ~ 3364036 (+)
G170244 NA non-coding upstream 8660 3245746 ~ 3249130 (+)
G170263 NA non-coding upstream 118734 3138803 ~ 3139056 (+)
G170260 NA non-coding upstream 126370 3131137 ~ 3131420 (+)
G170165 NA non-coding upstream 195762 3061481 ~ 3062028 (+)
G170073 NA non-coding upstream 372189 2881891 ~ 2885601 (+)
G170276 NA non-coding downstream 1713 3259782 ~ 3260036 (+)
G170280 NA non-coding downstream 23337 3281406 ~ 3283172 (+)
CI01000034_03432846_03437608 NDUFA4, NDUFA4L non-coding downstream 176067 3432846 ~ 3438839 (+)
G170305 NA non-coding downstream 318358 3576427 ~ 3576638 (+)
G169806 NA other upstream 920100 2317973 ~ 2337690 (+)
CI01000034_01729413_01730790 EVE1 other upstream 1526613 1729413 ~ 1731179 (+)
G169340 NA other upstream 1946912 1250219 ~ 1310878 (+)
G169394 NA other upstream 2064230 1150297 ~ 1193560 (+)
G169357 NA other upstream 2138771 1053543 ~ 1119019 (+)
CI01000034_04125435_04125780 RPRML other downstream 867031 4125100 ~ 4126825 (+)
CI01000034_04192675_04200041 NA other downstream 936569 4192311 ~ 4200636 (+)

Expression


Co-expression Network