G183438


Basic Information

Item Value
gene id G183438
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 182467 ~ 182743 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU208314
GACCCGTAGACGAGGAGTTTCTCAGCAAGTTAGATTCTCTTGTTGGGCTCGTGCTCGTCTTCCGCTGGGTCGTCCTGTCTCCTGCTTTCTCGGTGGTCTCTCCTGCCTGTGTGTCAGCTGTCGTGTGCGCAAGACACAGCGAGAGCCACCAAACAGTTTCCTCAAACTGTCACCAGTTACTTTGACTATTATTTTTGGTGTCTCAGGTTTCACCCTGAATAAACTTGTTCTTTTGTTCACCGCAACTTGAGTCCTCCTTTCATTCACCGTCCGACAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU208314 True 277 lncRNA 0.50 1 182467 182743

Neighbor

gene id symbol gene type direction distance location
CI01000040_00178642_00181455 NA coding upstream 276 178604 ~ 182404 (+)
CI01000040_00240852_00305487 GABRB2 coding downstream 58109 240849 ~ 313275 (+)
CI01000040_00347516_00350540 NA coding downstream 164773 347516 ~ 350601 (+)
CI01000040_00366809_00384965 NA coding downstream 183966 366709 ~ 385259 (+)
CI01000040_00512880_00513451 NA coding downstream 330137 512880 ~ 513597 (+)
CI01000040_00554753_00561571 NA coding downstream 372010 554753 ~ 562993 (+)
G183419 NA non-coding upstream 3543 131782 ~ 178924 (+)
G183433 NA non-coding upstream 8632 171309 ~ 173835 (+)
G183386 NA non-coding upstream 100491 78348 ~ 81976 (+)
G183370 NA non-coding upstream 134191 19599 ~ 48276 (+)
G183440 NA non-coding downstream 5719 188462 ~ 188747 (+)
G183421 NA non-coding downstream 18309 201052 ~ 253362 (+)
G183456 NA non-coding downstream 149676 332419 ~ 332645 (+)
G183459 NA non-coding downstream 154076 336819 ~ 337033 (+)
G183420 NA other upstream 17545 157543 ~ 164922 (+)
G183366 NA other upstream 122070 53691 ~ 60397 (+)
CI01000040_00977184_00977458 NDUA2, NDUFA2 other downstream 791370 977184 ~ 978163 (+)
G184003 NA other downstream 1047549 1230292 ~ 1236489 (+)
G185296 NA other downstream 3150835 3333578 ~ 3333983 (+)
G185884 NA other downstream 3556244 3738987 ~ 3739281 (+)

Expression


Co-expression Network