G197615


Basic Information

Item Value
gene id G197615
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 6242673 ~ 6249986 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU224325
GTTGATATCGATGCCCGCCTGGATCAGCAGTCTGATGATGTCGATGTGTCCGTTCTTGGCAGCGAGATGCAGTGGGCTGGTGCCGTTGGGATCAGTCGAGTCTCCGGGCTTGGCCTCCAACAGAGCTGCACACATGTTACTGCTCAGTAGCAGCTGGACCACCCCAACTCGGCCAAATTCACAAGCCAGGTCCAATGGAGTCTTCCCAGCATTGTCCACTATGCAGGGGTTTGACTGGTGCTGCAGAAGCATCTCAGATACGTCATAGTGTCCGTGCTGAGCGGCCAGGTGCAGGGGGATCTGACCCTCATCAGACTGACCGTTCACTGAGGAGCCTGACTTCAGCAGCAACTTCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU224325 True 356 lncRNA 0.56 4 6242673 6249986

Neighbor

gene id symbol gene type direction distance location
CI01000046_06202182_06214539 TRAF7.S, TRAF7 coding upstream 28113 6202182 ~ 6214560 (+)
CI01000046_06179800_06180706 NA coding upstream 61756 6179194 ~ 6180917 (+)
CI01000046_06168140_06169381 RPUSD1 coding upstream 73169 6167812 ~ 6169504 (+)
CI01000046_06145016_06162787 TNRC6A coding upstream 79886 6145016 ~ 6162787 (+)
CI01000046_06077232_06091190 RBBP6 coding upstream 151073 6077232 ~ 6091600 (+)
CI01000046_06330849_06347081 CRLF3 coding downstream 80863 6330849 ~ 6347379 (+)
CI01000046_06362326_06364947 NA coding downstream 111804 6361790 ~ 6371457 (+)
CI01000046_06465424_06470835 SCPEP1 coding downstream 215438 6465424 ~ 6470994 (+)
CI01000046_06489840_06506540 TUBG1, TUBG1.L, TUBG2 coding downstream 239634 6489620 ~ 6507607 (+)
CI01000046_06553680_06556870 NA coding downstream 302340 6552326 ~ 6557725 (+)
G197611 NA non-coding upstream 52515 6189910 ~ 6190158 (+)
G197608 NA non-coding upstream 56468 6185995 ~ 6186205 (+)
G197605 NA non-coding upstream 64060 6178397 ~ 6178613 (+)
G197400 NA non-coding upstream 119481 6122568 ~ 6123192 (+)
G197427 NA non-coding upstream 143179 6099199 ~ 6099494 (+)
G197676 NA non-coding downstream 77973 6327959 ~ 6328302 (+)
G197680 NA non-coding downstream 131175 6381161 ~ 6381468 (+)
G197683 NA non-coding downstream 134251 6384237 ~ 6384558 (+)
G197684 NA non-coding downstream 135066 6385052 ~ 6419782 (+)
G197528 NA other upstream 499989 5726121 ~ 5742684 (+)
G197352 NA other upstream 966220 5259318 ~ 5276453 (+)
G196869 NA other upstream 1820986 4415530 ~ 4421687 (+)
G197121 NA other upstream 1871243 4371011 ~ 4371430 (+)
G197055 NA other upstream 2092893 4149423 ~ 4149780 (+)
CI01000046_06808895_06820945 GSPT1, ERF3B, GSPT1L other downstream 569952 6808507 ~ 6821543 (+)

Expression


Co-expression Network