CI01000049_05910501_05913204 (SPCS3.L, SPCS3)


Basic Information

Item Value
gene id CI01000049_05910501_05913204
gene name SPCS3.L, SPCS3
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 5910501 ~ 5913261 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000049_05910501_05913204.mRNA
TTGTTAACTAGATTGAATCATGAATACGGTATTGTCGAGGGCGAACTCGCTCTTCGCCTTCTCTCTCAGTGTGATGGCCGCGCTCACATTCGGATGCTTCATTACTACAGCGTTCAAAGACAGAAGCGTACCGGTGGATATACACGTATCCAAAGTCATGCTCCAATATTTGACTGGAATGTGAAGGAGCTCTTTCTTTACCTGACTGCTGAATATTCAACTAAAAGCAATGCACTGAACCAGGTGGTTCTATGGGACAAGATTGTCTTGAGAGGAGACAACACCAAACTAAACCTGAAGGAGGTTAAATCCAAGTACTTCTTCTTTGATGATGGGAATGGTTTAAGGGCGAATAAGAACATCACTCTCACTCTCTCATGGAATGTGGTGCCAAATGCTGGAATCCTGCCATTGGTCATGGGATCAGGACACAAGAGTCTCGCCTTCCCTGAATCATATGAAACAGCAAAGAGCTACTGAACTGTTCCAGTCCATCCCAAACCATATTTGTAAATGTTGTGCTCTGTACGGGTTTTA

Function

symbol description
spcs3 Predicted to enable peptidase activity. Predicted to be involved in protein targeting to ER and signal peptide processing. Predicted to be located in endoplasmic reticulum and membrane. Predicted to be integral component of membrane. Predicted to be part of signal peptidase complex. Orthologous to human SPCS3 (signal peptidase complex subunit 3).

GO:

id name namespace
GO:0005787 signal peptidase complex cellular_component

KEGG:

id description
K12948 SPCS3, SPC3; signal peptidase complex subunit 3

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000049_05910501_05913204.mRNA True 537 mRNA 0.44 4 5910501 5913261

Neighbor

gene id symbol gene type direction distance location
CI01000049_05878283_05898645 WDR17 coding upstream 11490 5878283 ~ 5899011 (+)
CI01000049_05620218_05631333 NA coding upstream 279168 5620218 ~ 5631333 (+)
CI01000049_05489957_05511003 GALNT7 coding upstream 399498 5486522 ~ 5511003 (+)
CI01000049_05431306_05477613 GALNTL6 coding upstream 432324 5431306 ~ 5478177 (+)
CI01000049_05319353_05347573 GALNTL6 coding upstream 562863 5318886 ~ 5352037 (+)
CI01000049_06307987_06341121 NA coding downstream 392923 6306184 ~ 6341341 (+)
CI01000049_06385432_06392281 NA coding downstream 471264 6384525 ~ 6392981 (+)
CI01000049_06466105_06468489 NA coding downstream 552844 6466105 ~ 6470789 (+)
CI01000049_06475969_06494373 NA coding downstream 562589 6475850 ~ 6494644 (+)
CI01000049_06507924_06593757 TENM3 coding downstream 593195 6506456 ~ 6594193 (+)
G208828 NA non-coding upstream 1265 5908945 ~ 5909236 (+)
G208823 NA non-coding upstream 262975 5645811 ~ 5647526 (+)
G208819 NA non-coding upstream 264779 5645297 ~ 5645722 (+)
G208816 NA non-coding upstream 265405 5642188 ~ 5645096 (+)
G208945 NA non-coding upstream 315424 5594358 ~ 5595077 (+)
G209010 NA non-coding downstream 10289 5923550 ~ 5923754 (+)
G209011 NA non-coding downstream 10496 5923757 ~ 5923990 (+)
G208810 NA non-coding downstream 16844 5930105 ~ 5957565 (+)
G209030 NA non-coding downstream 55512 5968773 ~ 5969276 (+)
G209034 NA non-coding downstream 68660 5981921 ~ 5982309 (+)
CI01000049_04473766_04475768 GM10043, LSM6, SNRPF, BRAFLDRAFT_125735 other upstream 1434231 4473662 ~ 4476270 (+)
G208074 NA other upstream 2028290 3877396 ~ 3882211 (+)
G207888 NA other upstream 2286190 3624002 ~ 3624311 (+)
CI01000049_01840330_01843844 FGF8B other upstream 4066673 1839815 ~ 1844077 (+)
G209660 NA other downstream 964872 6878133 ~ 6882030 (+)
CI01000049_07219171_07224229 NA other downstream 1305587 7218811 ~ 7224268 (+)
G210091 NA other downstream 1960489 7873750 ~ 7878856 (+)
CI01000049_08326623_08329601 NA other downstream 2414691 8326285 ~ 8329915 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_000448 spcs3 coding NC_007112.7 CM002885.2 38818268 ~ 38822167 (+)
striped catfish (Pangasianodon hypophthalmus) G382040 NA non-coding NC_047621.1 CM018567.1 6132107 ~ 6134425 (-)