G214113


Basic Information

Item Value
gene id G214113
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 2808537 ~ 2808738 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU242879
TTTGTCAGTTGCGTCTTGTTCCGTGTTCACAACAATTCAGTCTTTTCAATGTAAAAGTCTTCGCTACTGACTGACACACTCATAAAGACAGTCTTTGCCGCCATCTAATGGTGTAATAATGTAACTTCTGTTGCTGTTCATGGTCAGGGACTATTTTTTCCGGTGGAAGGAAGGCTTTTAGAAAAAGTTTACTTCATGAAAG

Function

NR:

description
PREDICTED: baculoviral IAP repeat-containing protein 5-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU242879 True 202 lncRNA 0.39 1 2808537 2808738

Neighbor

gene id symbol gene type direction distance location
CI01000050_02785728_02797909 PHYHIP coding downstream 10628 2785556 ~ 2797909 (-)
CI01000050_02752537_02755836 COX5B.1, COX5B1, COX5B coding downstream 52701 2752032 ~ 2755922 (-)
CI01000050_02528520_02596972 TCF7L1B, TCF7L1, TCF7L1A coding downstream 211565 2528520 ~ 2596972 (-)
CI01000050_02503125_02509915 NA coding downstream 298499 2502592 ~ 2510038 (-)
CI01000050_02488032_02496421 STAMBPB coding downstream 311282 2487711 ~ 2497255 (-)
CI01000050_02945824_02971282 GNA14, GNA14A coding upstream 136183 2944921 ~ 2971369 (-)
CI01000050_03142876_03156191 KLHL22 coding upstream 334073 3142811 ~ 3158564 (-)
CI01000050_03362364_03363241 NA coding upstream 553546 3362284 ~ 3364257 (-)
CI01000050_03491159_03514757 NA coding upstream 682350 3491088 ~ 3514757 (-)
CI01000050_03635030_03637939 NA coding upstream 825835 3634573 ~ 3639160 (-)
G214064 NA non-coding downstream 56620 2749671 ~ 2751917 (-)
G214069 NA non-coding downstream 61348 2734987 ~ 2747189 (-)
G214054 NA non-coding downstream 199519 2608805 ~ 2609018 (-)
G214048 NA non-coding downstream 287822 2520290 ~ 2520715 (-)
G214123 NA non-coding upstream 23957 2832695 ~ 2833909 (-)
G214124 NA non-coding upstream 26978 2835716 ~ 2837272 (-)
G214138 NA non-coding upstream 49920 2858658 ~ 2859362 (-)
G214141 NA non-coding upstream 62094 2870832 ~ 2871163 (-)
G214170 NA non-coding upstream 119826 2928564 ~ 2930333 (-)
G214027 NA other downstream 235635 2557166 ~ 2572902 (-)
G214017 NA other downstream 343839 2462176 ~ 2464698 (-)
G213948 NA other downstream 477221 2328513 ~ 2331316 (-)
CI01000050_02230904_02233429 NA other downstream 567648 2228865 ~ 2233429 (-)
G213704 NA other downstream 1491431 1312983 ~ 1317106 (-)
G214314 NA other upstream 604710 3413448 ~ 3424257 (-)
G214436 NA other upstream 717078 3525816 ~ 3589057 (-)
CI01000050_04564233_04580815 KANSL3 other upstream 1754949 4563687 ~ 4581278 (-)
G215935 NA other upstream 2240178 5048916 ~ 5073109 (-)

Expression


Co-expression Network