G215250


Basic Information

Item Value
gene id G215250
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 4592039 ~ 4593166 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU244207
AACAATACAATCAAATCATAAACAATAAGGTAACTGGAATGTAATTCATACTTTTTCCTTACAAAATTATTTTATATTTTCGTAATTTTACAGTAAAATTATCTTCCAGCATGTATTGGCCTCTATACATGGACAAGTGCTAGGTATAAACTAATTTTACAGATATAAGATGTTCTCTTATTAGCTTTAATTTAAAAATAAGAGCTTTTTCTTTGATAAAAGTAAGAAGGAAAGCCTTGAATGCTAGACCTTTTGGTTAACAAGATTTAACCTTTTTTAGTTGTTTATTAATTACAATTGATAATCCAGTTTGGATCCAAAAGCAGTTTATATTCATTTTAGTCAAAATACGTACACATCACTGATTTGTATTTTCAATCATTGGAAATTATTTTCCAACAGCACCATAGGAACACATAATGGTGGGATCTTCTGGATGAAACACTTTAAATGTGCATGTTCTGTAATCATACTTCACAATGCAGCCTCCAGTCTTGATTATGGGTTTACCCACATGTCACAGCATGACATCATGTTGGAGGAGCATGTGCATCGGATGCATCTGTTGTTTGTCCAAGTACTTCCTACTGGATGCTGGGATTTATCATCTGCATCCGTACAATATCTTGCCCCTTTATAAAAAATTTAAAGTAATTGTGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU244207 True 660 lncRNA 0.32 2 4592039 4593166

Neighbor

gene id symbol gene type direction distance location
CI01000050_04564233_04580815 KANSL3 coding downstream 10761 4563687 ~ 4581278 (-)
CI01000050_04442645_04542984 BMP1A, BMP1 coding downstream 48776 4442415 ~ 4543263 (-)
CI01000050_04291776_04301169 RAB7A, RAB7 coding downstream 290870 4291757 ~ 4301169 (-)
CI01000050_04247305_04272766 NA coding downstream 319273 4247044 ~ 4272766 (-)
CI01000050_04208939_04225972 ACSL2 coding downstream 366067 4208939 ~ 4225972 (-)
CI01000050_04702299_04703455 NA coding upstream 109077 4702243 ~ 4703455 (-)
CI01000050_04732489_04733933 NA coding upstream 138820 4731986 ~ 4733933 (-)
CI01000050_04781467_04784451 NA coding upstream 187837 4781003 ~ 4784587 (-)
CI01000050_04786504_04807380 NA coding upstream 193150 4786316 ~ 4810352 (-)
CI01000050_04821454_04823915 NA coding upstream 227955 4821121 ~ 4823915 (-)
G215220 NA non-coding downstream 9817 4551054 ~ 4582222 (-)
G215193 NA non-coding downstream 190188 4352796 ~ 4401851 (-)
G215209 NA non-coding downstream 191867 4383672 ~ 4400172 (-)
G215189 NA non-coding downstream 252973 4338475 ~ 4339066 (-)
G215188 NA non-coding downstream 254640 4337094 ~ 4337399 (-)
G215832 NA non-coding upstream 155475 4748641 ~ 4748922 (-)
G215839 NA non-coding upstream 180212 4773378 ~ 4776171 (-)
G215880 NA non-coding upstream 286706 4879872 ~ 4880156 (-)
G215872 NA non-coding upstream 313375 4906541 ~ 4908151 (-)
G215904 NA non-coding upstream 318599 4911765 ~ 4912036 (-)
G214436 NA other downstream 1002982 3525816 ~ 3589057 (-)
CI01000050_03491159_03514757 NA other downstream 1081248 3491088 ~ 3514757 (-)
G214314 NA other downstream 1167782 3413448 ~ 3424257 (-)
G214027 NA other downstream 2019137 2557166 ~ 2572902 (-)
G214017 NA other downstream 2127341 2462176 ~ 2464698 (-)
G215935 NA other upstream 455750 5048916 ~ 5073109 (-)
G216093 NA other upstream 896391 5489557 ~ 5552103 (-)
G216408 NA other upstream 1762851 6356017 ~ 6356511 (-)
G216931 NA other upstream 2570929 7164095 ~ 7165401 (-)

Expression


Co-expression Network