G216187


Basic Information

Item Value
gene id G216187
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 5815303 ~ 5815538 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU245243
TTTCACTGTTCGATTCATAAGCTTGCGATTCGATGTCGTGTCACAGGCACCTCCTTCAGCCACTTTGCAAGAGTGGAGATCTTCAACAGGCCTACACCTTTTTTCTTTCGCAGATTCTGTCTGTATTTCCATAGAATCTTTCACGTTGTCCATCAATTCAAAGTACAAAGTGGCTGTTGAGTATTGTTAGAACATAAAACAAAGTTAAAATCACCAAAAGTTTATTTAAAAAAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU245243 True 236 lncRNA 0.37 1 5815303 5815538

Neighbor

gene id symbol gene type direction distance location
CI01000050_05800641_05808346 TPRG1L coding downstream 6957 5800004 ~ 5808346 (-)
CI01000050_05766242_05770223 NA coding downstream 45080 5765796 ~ 5770223 (-)
CI01000050_05728696_05760342 TP73 coding downstream 54499 5728465 ~ 5760804 (-)
CI01000050_05717074_05720876 RER1 coding downstream 94176 5716554 ~ 5721127 (-)
CI01000050_05654964_05705049 AAK1, AAK1A coding downstream 110254 5653791 ~ 5705049 (-)
CI01000050_05851079_05852014 NA coding upstream 35449 5850987 ~ 5852064 (-)
CI01000050_06320386_06342648 CLCN6 coding upstream 504160 6319698 ~ 6342648 (-)
CI01000050_06359307_06399573 NA coding upstream 543694 6359232 ~ 6399597 (-)
CI01000050_06401583_06407303 PEX10 coding upstream 585853 6401391 ~ 6407323 (-)
CI01000050_06638872_06648965 KANK3 coding upstream 823334 6638872 ~ 6649572 (-)
G216146 NA non-coding downstream 17078 5795380 ~ 5798225 (-)
G216167 NA non-coding downstream 29280 5776207 ~ 5786023 (-)
G216149 NA non-coding downstream 177736 5634273 ~ 5637567 (-)
G216130 NA non-coding downstream 226015 5588550 ~ 5589288 (-)
CI01000050_05461249_05502636 NA non-coding downstream 264557 5460472 ~ 5502886 (-)
G216180 NA non-coding upstream 23688 5839226 ~ 5840157 (-)
G216176 NA non-coding upstream 24714 5840252 ~ 5841706 (-)
G216181 NA non-coding upstream 27674 5843212 ~ 5844059 (-)
G216178 NA non-coding upstream 59955 5875493 ~ 5876521 (-)
G216177 NA non-coding upstream 84577 5900115 ~ 5907319 (-)
G216093 NA other downstream 263200 5489557 ~ 5552103 (-)
G215935 NA other downstream 742194 5048916 ~ 5073109 (-)
CI01000050_04564233_04580815 KANSL3 other downstream 1202411 4563687 ~ 4581278 (-)
G214436 NA other downstream 2226246 3525816 ~ 3589057 (-)
CI01000050_03491159_03514757 NA other downstream 2304512 3491088 ~ 3514757 (-)
G216408 NA other upstream 540479 6356017 ~ 6356511 (-)
G216931 NA other upstream 1348557 7164095 ~ 7165401 (-)

Expression


Co-expression Network