G230251


Basic Information

Item Value
gene id G230251
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 1144174 ~ 1144586 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU261291
TTACAATAAAAATAATTTGATATTAATACTTGTGACAACATGAACTTTAAATTCAATTATGACAGCCATGACAAAAAAATTAAGAAATACTGGATTAAACAAGTCTGAACATTCAACTGTTTTCTCTCTAAATTAATTTCTTCTACTTGGTCAGTTTTTAAAGAATATGAATTGTCAGTAACACTGAAAATTACAAAAGAAAATGAACTTGAATTACATGTAATGATGCTTATAAACCAGATCCATTGCTCATGGATTCTAAAACATACATTTGAACCAAGGATATCATGCTTTTTACATGTATAACCAAAACAACAACCATTTAGCTTATAATGCCTAACAAAATCTGAGAGCAATCTTTCTTGTTAAATCAGTAATATGTGCATGTCTGCTTGTATTTTTCTTGACCTCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU261291 True 413 lncRNA 0.28 1 1144174 1144586

Neighbor

gene id symbol gene type direction distance location
CI01000054_01115294_01116274 GPR3, GPR6, GPR186 coding downstream 27352 1114693 ~ 1116822 (-)
CI01000054_00979998_00989171 TCEB3 coding downstream 155003 979998 ~ 989171 (-)
CI01000054_00974025_00979306 PITHD1 coding downstream 164868 973900 ~ 979306 (-)
CI01000054_00965111_00970121 LYPLA2, LYPA2 coding downstream 174053 964642 ~ 970121 (-)
CI01000054_00929337_00955240 ANKIB1A coding downstream 188500 929132 ~ 955674 (-)
CI01000054_01151083_01156699 FAM83HB coding upstream 6138 1150724 ~ 1158172 (-)
CI01000054_01203148_01209012 PPT1 coding upstream 58319 1202905 ~ 1209135 (-)
CI01000054_01246516_01250511 KLHL43 coding upstream 100295 1244881 ~ 1251249 (-)
CI01000054_01257527_01259314 NA coding upstream 112941 1257527 ~ 1259314 (-)
CI01000054_01266491_01275814 NA coding upstream 120774 1265360 ~ 1275814 (-)
G230356 NA non-coding downstream 32656 1111266 ~ 1111518 (-)
G230346 NA non-coding downstream 80213 1063761 ~ 1063961 (-)
G230344 NA non-coding downstream 81260 1062613 ~ 1062914 (-)
G230343 NA non-coding downstream 82282 1061572 ~ 1061892 (-)
G230189 NA non-coding downstream 86732 1055550 ~ 1057442 (-)
G230380 NA non-coding upstream 23904 1168490 ~ 1168820 (-)
G230178 NA non-coding upstream 81837 1185533 ~ 1230135 (-)
G230216 NA non-coding upstream 86572 1231158 ~ 1231451 (-)
G230241 NA non-coding upstream 91239 1235825 ~ 1238155 (-)
G230211 NA non-coding upstream 93758 1238344 ~ 1239047 (-)
G230923 NA other upstream 1692651 2837237 ~ 2837682 (-)
CI01000054_02857402_02860451 NA other upstream 1709555 2857402 ~ 2860573 (-)
G230908 NA other upstream 1913062 3057648 ~ 3063343 (-)
G231645 NA other upstream 2837261 3981847 ~ 3982823 (-)

Expression


Co-expression Network