G230216


Basic Information

Item Value
gene id G230216
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 1231158 ~ 1231451 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU261256
AAAAGACACGCCCAGAATAAACTTGTCATAGAGATATATTAGTCACCGGAAGTCACCCGGCTGGTGACGTACCTCAGCGGCTTCTTTCTCAAACTTCTCGATGGTTCTCTTATCGATGCCTCCACATTTGTAGATCAGATGGCCGGTGGTGGTGGACTTGCCAGAATCGACATGGCCGATAACCACGATGTTAATATGAATCTTTTCCTTACCCATGTTGTAAATTTACTGTGGAAAGACATTGCTGGTTTAGTTTCGACGGTATAAACACTTAAACACAAATTACACATTAGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU261256 True 294 lncRNA 0.43 1 1231158 1231451

Neighbor

gene id symbol gene type direction distance location
CI01000054_01203148_01209012 PPT1 coding downstream 22023 1202905 ~ 1209135 (-)
CI01000054_01151083_01156699 FAM83HB coding downstream 72986 1150724 ~ 1158172 (-)
CI01000054_01115294_01116274 GPR3, GPR6, GPR186 coding downstream 114336 1114693 ~ 1116822 (-)
CI01000054_00979998_00989171 TCEB3 coding downstream 241987 979998 ~ 989171 (-)
CI01000054_00974025_00979306 PITHD1 coding downstream 251852 973900 ~ 979306 (-)
CI01000054_01246516_01250511 KLHL43 coding upstream 13430 1244881 ~ 1251249 (-)
CI01000054_01257527_01259314 NA coding upstream 26076 1257527 ~ 1259314 (-)
CI01000054_01266491_01275814 NA coding upstream 33909 1265360 ~ 1275814 (-)
CI01000054_01294452_01302654 NA coding upstream 62753 1294204 ~ 1303671 (-)
CI01000054_01307641_01325658 PUM1, PUM1.S coding upstream 75512 1306963 ~ 1325658 (-)
G230178 NA non-coding downstream 1023 1185533 ~ 1230135 (-)
G230380 NA non-coding downstream 62338 1168490 ~ 1168820 (-)
G230251 NA non-coding downstream 86572 1144174 ~ 1144586 (-)
G230356 NA non-coding downstream 119640 1111266 ~ 1111518 (-)
G230346 NA non-coding downstream 167197 1063761 ~ 1063961 (-)
G230241 NA non-coding upstream 4374 1235825 ~ 1238155 (-)
G230211 NA non-coding upstream 6893 1238344 ~ 1239047 (-)
G230231 NA non-coding upstream 12362 1243813 ~ 1244332 (-)
G230281 NA non-coding upstream 76735 1308186 ~ 1311785 (-)
CI01000054_01336032_01344581 NA non-coding upstream 110635 1335990 ~ 1344621 (-)
G230923 NA other upstream 1605786 2837237 ~ 2837682 (-)
CI01000054_02857402_02860451 NA other upstream 1622690 2857402 ~ 2860573 (-)
G230908 NA other upstream 1826197 3057648 ~ 3063343 (-)
G231645 NA other upstream 2750396 3981847 ~ 3982823 (-)
CI01000054_04671351_04681181 PEF1 other upstream 3438700 4670151 ~ 4681361 (-)

Expression


Co-expression Network