RNA id: TCONS_00001834


Basic Information

Item Value
RNA id TCONS_00001834
length 399
RNA type processed_transcript
GC content 0.52
exon number 2
gene id XLOC_001151
representative True

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 18642117 ~ 18772311 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCAGAGTAAAGGTGAAAACGTTGGAAAGTGGAGAGTAGCTCTGATGGAGGGATGAGGGAGAACACATTCAGGTTCGGACATGCCTTCTCTGCGTAGATGGCTGAATCAGGTTCCAGAGATCATCAGCACTCTCAGACAGGCTGGCAAAAGCTCTGCCCGGCAAGAAGACACTCCATCACTGCCTAGCAACGGTCAATCAGATGCCTCCAGCTCCACGGCAACAGCAGCTGATGCAGCCACAGCCTTCGCTAAAAAGTTTGAGGTGTTGTTCTGCGGGCGAGTGGTGGTGGCCCATAAGAAAGCACCTCCTGCACTAATAGATGAGTGTATAGAGAAGTTTGGACGTGTCAGTGTTACAGGCTCACTTGCAGCGGGCATCAGGCGGGCGTTTTCACTCAA

Function

GO:

id name namespace
GO:0006886 intracellular protein transport biological_process
GO:0090630 activation of GTPase activity biological_process
GO:0005096 GTPase activator activity molecular_function

KEGG:

id description
ko04152 AMPK signaling pathway
ko04131 Membrane trafficking

ZFIN:

id description
ZDB-GENE-060710-1 Predicted to enable GTPase activator activity. Predicted to be involved in activation of GTPase activity and intracellular protein transport. Orthologous to human TBC1D1 (TBC1 domain family member 1).

Ensembl:

ensembl_id ENSDART00000139190

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003392 lncRNA downstream 488419 18233995 ~ 18237940 (-) False XLOC_001144
TCONS_00003391 lncRNA downstream 488419 18233995 ~ 18237940 (-) False XLOC_001144
TCONS_00003390 lncRNA downstream 488589 18230296 ~ 18237770 (-) False XLOC_001144
TCONS_00003389 lncRNA downstream 488601 18230296 ~ 18237758 (-) False XLOC_001144
TCONS_00003388 lncRNA downstream 488640 18217454 ~ 18237719 (-) False XLOC_001144
TCONS_00001840 lncRNA upstream 69273 18810891 ~ 18811483 (-) False XLOC_001153
TCONS_00001837 lncRNA upstream 69273 18810891 ~ 18811487 (-) False XLOC_001153
TCONS_00001839 lncRNA upstream 69276 18810894 ~ 18811484 (-) True XLOC_001153
TCONS_00003393 lncRNA upstream 192304 18933922 ~ 18936968 (-) True XLOC_001155
TCONS_00002942 lncRNA upstream 200781 18942399 ~ 18945609 (-) False XLOC_001156
TCONS_00001825 mRNA downstream 111296 18594146 ~ 18615063 (-) False XLOC_001150
TCONS_00001822 mRNA downstream 134291 18575747 ~ 18592068 (-) False XLOC_001149
TCONS_00001823 mRNA downstream 141313 18578251 ~ 18585046 (-) False XLOC_001149
TCONS_00001821 mRNA downstream 280198 18363833 ~ 18446161 (-) True XLOC_001148
TCONS_00001819 mRNA downstream 389481 18251335 ~ 18336878 (-) False XLOC_001147
TCONS_00001835 mRNA upstream 37550 18779168 ~ 18803919 (-) True XLOC_001152
TCONS_00001838 mRNA upstream 69273 18810891 ~ 18811517 (-) False XLOC_001153
TCONS_00001841 mRNA upstream 99844 18841462 ~ 18849029 (-) False XLOC_001154
TCONS_00001842 mRNA upstream 100018 18841636 ~ 18848955 (-) True XLOC_001154
TCONS_00001843 mRNA upstream 332708 19074326 ~ 19079957 (-) True XLOC_001157
TCONS_00001826 other downstream 111385 18605635 ~ 18614974 (-) True XLOC_001150
TCONS_00001824 other downstream 139161 18584948 ~ 18587198 (-) True XLOC_001149
TCONS_00001820 other downstream 389521 18252614 ~ 18336838 (-) True XLOC_001147
TCONS_00001817 other downstream 488688 18187612 ~ 18237671 (-) False XLOC_001144
TCONS_00001836 other upstream 69273 18810891 ~ 18811484 (-) False XLOC_001153
TCONS_00001850 other upstream 619587 19361205 ~ 19366174 (-) False XLOC_001163
TCONS_00001851 other upstream 627379 19368997 ~ 19402815 (-) True XLOC_001163
TCONS_00001874 other upstream 1101616 19843234 ~ 19845380 (-) True XLOC_001174
TCONS_00001878 other upstream 1739491 20481109 ~ 20553129 (-) False XLOC_001178

Expression Profile

//