RNA id: TCONS_00032273


Basic Information

Item Value
RNA id TCONS_00032273
length 878
RNA type mRNA
GC content 0.54
exon number 4
gene id XLOC_016378
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 24410494 ~ 24462277 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTGCACAGCTCCGGCCTGGAAGTGGTCGTCTCCAAGGGCGGAGGCGAAGACCCCAGCAAGGCGTCCAATGAGAGCCTGGTCCGAGAGAGCGGCAACGCACCGCAGAAGAAGAATAAAGATATTGGCTACAAACTGGGCCACAGGAGGGCACTTTTTGAGAAACGCAAGCGGCTCAGTGACTATGCCCTGATATTCGGCATGTTTGGGATCGTTGTGATGGTAACAGAGACTGAACTATCCTGGGGGGTTTACACTAAGGAATCTTCATATTCATTTGCACTGAAATGCCTTATCAGCCTTTCCACTGTTATTTTGCTTGGTCTTATAATAATGTACCACGCTCGGGAAATACAGCTGTTCATGGTGGACAATGGTGCGGATGACTGGAGGATAGCCATGACATACGAGCGCATCTTTTTCATTGTCCTGGAGCTGTTGGTGTGTGCCATTCACCCCATCCCGGGCCAGTACGTATTCACATGGACGGCCCGGCTGGCTTTCACCTACGTGCCCTCCGTGGCCGACGCCGACGTAGACATCATCCTCTCCATCCCCATGTTCCTTCGCCTCTACCTGATAGGCCGGGTTATGCTCCTTCATAGCAAACTGTTCACGGACGCATCTTCACGCAGTATAGGTGCCCTCAACAAGATCAACTTCAACACACGCTTCGTGATGAAGACCCTCATGACCATCTGTCCGGGCACCGTGCTGCTGGTCTTCAGCATCTCCTCCTGGATCATCGCGGCCTGGACCGTGCGGGTCTGTGAGAGGGATGCCATGTGAGTCCTCGTTCTCTAGCCGTGGAAAACCTATCATTGTTCATTGAGCTGGTGCCACTGCTGCTCTAAGAGGGGGGAGGGGTGGGATTCGGCAGC

Function

GO:

id name namespace
GO:0071805 potassium ion transmembrane transport biological_process
GO:0006811 ion transport biological_process
GO:0006813 potassium ion transport biological_process
GO:0043005 neuron projection cellular_component
GO:0043025 neuronal cell body cellular_component
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005516 calmodulin binding molecular_function
GO:0015269 calcium-activated potassium channel activity molecular_function
GO:0016286 small conductance calcium-activated potassium channel activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070912-703 Predicted to enable calmodulin binding activity and small conductance calcium-activated potassium channel activity. Predicted to be involved in potassium ion transmembrane transport. Predicted to act upstream of or within potassium ion transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in neuron projection; neuronal cell body; and plasma membrane. Orthologous to human KCNN1 (potassium calcium-activated channel subfamily N member 1).

Ensembl:

ensembl_id ENSDART00000147885

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00032266 lncRNA downstream 36592 24388454 ~ 24390955 (-) False XLOC_016377
TCONS_00032256 lncRNA downstream 110353 24314227 ~ 24317194 (-) False XLOC_016374
TCONS_00032257 lncRNA downstream 110356 24314336 ~ 24317191 (-) True XLOC_016374
TCONS_00032253 lncRNA downstream 110381 24313732 ~ 24317166 (-) False XLOC_016374
TCONS_00032252 lncRNA downstream 112803 24313726 ~ 24314744 (-) False XLOC_016374
TCONS_00033831 lncRNA upstream 83286 24528124 ~ 24536126 (-) True XLOC_016382
TCONS_00033832 lncRNA upstream 100642 24545480 ~ 24545941 (-) True XLOC_016383
TCONS_00032278 lncRNA upstream 107539 24552377 ~ 24554432 (-) False XLOC_016384
TCONS_00032279 lncRNA upstream 107615 24552453 ~ 24554432 (-) True XLOC_016384
TCONS_00032281 lncRNA upstream 110179 24555017 ~ 24565293 (-) False XLOC_016385
TCONS_00032270 mRNA downstream 19614 24402892 ~ 24407933 (-) True XLOC_016377
TCONS_00032269 mRNA downstream 19815 24400725 ~ 24407732 (-) False XLOC_016377
TCONS_00032268 mRNA downstream 19815 24400725 ~ 24407732 (-) False XLOC_016377
TCONS_00032267 mRNA downstream 19815 24400725 ~ 24407732 (-) False XLOC_016377
TCONS_00032265 mRNA downstream 25206 24387258 ~ 24402341 (-) False XLOC_016377
TCONS_00032274 mRNA upstream 42482 24487320 ~ 24488652 (-) True XLOC_016379
TCONS_00032275 mRNA upstream 50966 24495804 ~ 24505185 (-) True XLOC_016380
TCONS_00032277 mRNA upstream 103411 24548249 ~ 24554416 (-) False XLOC_016384
TCONS_00032282 mRNA upstream 133215 24578053 ~ 24603325 (-) True XLOC_016387
TCONS_00032283 mRNA upstream 452154 24896992 ~ 24898226 (-) True XLOC_016390
TCONS_00032260 other downstream 86691 24337873 ~ 24340856 (-) True XLOC_016375
TCONS_00032255 other downstream 110323 24313763 ~ 24317224 (-) False XLOC_016374
TCONS_00032251 other downstream 110339 24311767 ~ 24317208 (-) False XLOC_016374
TCONS_00032254 other downstream 110342 24313745 ~ 24317205 (-) False XLOC_016374
TCONS_00032244 other downstream 146752 24278839 ~ 24280795 (-) False XLOC_016373
TCONS_00032276 other upstream 61137 24505975 ~ 24506090 (-) True XLOC_016381
TCONS_00032280 other upstream 113289 24558127 ~ 24560752 (-) True XLOC_016385
TCONS_00032289 other upstream 509477 24954315 ~ 24956898 (-) False XLOC_016393
TCONS_00032296 other upstream 711004 25155842 ~ 25155958 (-) True XLOC_016398
TCONS_00032302 other upstream 1407841 25852679 ~ 25853799 (-) False XLOC_016403

Expression Profile

//