RNA id: TCONS_00034781


Basic Information

Item Value
RNA id TCONS_00034781
length 596
RNA type mRNA
GC content 0.41
exon number 3
gene id XLOC_017501
representative True

Chromosome Information

Item Value
chromosome id NC_007131.7
NCBI id CM002904.2
chromosome length 55201332
location 36623807 ~ 36626569 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTTTACTAAACCATGCCTTATTATCAAACATGGGAAGAGTTTGCGCGAGCTGCCGAAAAACTTTACTTGACGGACCCAATGAAGGTCAGAGTGGTGCTGAAATACAGACACTGTGATGGAAATCTCTGTATGAAGGTCACAGATGATGCTGTTTACAAGACTGACCAGGCCCAAGATGTGAAGAAGGTTGAGAAACTGCATGGGAAACTGATGAGATTAATGGTCTCCAAAGAGACTCACAGTGGGTCAATGGAAACAGACTGAAGTCGTCAAATGAAACCGTTGGAATTGGACAGTTGTTTTTGACTCGGTCTGACTGACAATGAAGAGAGACTGATTTCTAGGAGGATCGAGAAGACGTTTGGTTGATTGTTTTTTTGACTGATGTCCATATGCTCATGTGGAGAGCAAGCAGCCAGAGCATCTTACAAGGGGCTGATATTTGTGTTATTCTGAAAGTTGGACAACGTTGTAATGGTCATACTGTTGTTTTCATTTGGTCTGCCTATTATTTAATGTTTGGAGGACGTAGATTTTTAACTGCAACATCAAGGGATGAATTTCATAAGTCTGTATTTTGTATATCTAAGCCTGAT

Function

GO:

id name namespace
GO:0006614 SRP-dependent cotranslational protein targeting to membrane biological_process
GO:0045900 negative regulation of translational elongation biological_process
GO:0005786 signal recognition particle, endoplasmic reticulum targeting cellular_component
GO:0048500 signal recognition particle cellular_component
GO:0005737 cytoplasm cellular_component
GO:0003723 RNA binding molecular_function
GO:0008312 7S RNA binding molecular_function

KEGG:

id description
ko03060 Protein export
ko02044 Secretion system

ZFIN:

id description
ZDB-GENE-040426-1106 Predicted to enable 7S RNA binding activity. Predicted to be involved in SRP-dependent cotranslational protein targeting to membrane. Predicted to act upstream of or within negative regulation of translational elongation. Predicted to be located in cytoplasm. Predicted to be part of signal recognition particle, endoplasmic reticulum targeting. Orthologous to human SRP9 (signal recognition particle 9).

Ensembl:

ensembl_id ENSDART00000062895

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00036399 lncRNA upstream 319785 36302797 ~ 36304106 (+) True XLOC_017500
TCONS_00036627 lncRNA upstream 669650 35857399 ~ 35954241 (+) False XLOC_017496
TCONS_00036398 lncRNA upstream 796686 35712858 ~ 35827205 (+) False XLOC_017495
TCONS_00036400 lncRNA downstream 55613 36682146 ~ 36704359 (+) False XLOC_017503
TCONS_00036401 lncRNA downstream 88370 36714903 ~ 36715819 (+) True XLOC_017504
TCONS_00036628 lncRNA downstream 156881 36783414 ~ 36791968 (+) True XLOC_017503
TCONS_00036629 lncRNA downstream 164406 36790939 ~ 36796506 (+) True XLOC_017505
TCONS_00036630 lncRNA downstream 218581 36845114 ~ 36851296 (+) True XLOC_017508
TCONS_00034776 mRNA upstream 325751 36233873 ~ 36298140 (+) False XLOC_017498
TCONS_00034778 mRNA upstream 333566 36234335 ~ 36290325 (+) False XLOC_017498
TCONS_00034777 mRNA upstream 333566 36234335 ~ 36290325 (+) True XLOC_017498
TCONS_00034774 mRNA upstream 587195 35998073 ~ 36036696 (+) False XLOC_017497
TCONS_00034775 mRNA upstream 587195 36010080 ~ 36036696 (+) True XLOC_017497
TCONS_00034782 mRNA downstream 1526 36628059 ~ 36638179 (+) False XLOC_017502
TCONS_00034783 mRNA downstream 2640 36629173 ~ 36637503 (+) True XLOC_017502
TCONS_00034784 mRNA downstream 55518 36682051 ~ 36792710 (+) False XLOC_017503
TCONS_00034785 mRNA downstream 103516 36730049 ~ 36791717 (+) False XLOC_017503
TCONS_00034786 mRNA downstream 179865 36806398 ~ 36816964 (+) False XLOC_017506
TCONS_00034779 other upstream 343727 36280048 ~ 36280164 (+) True XLOC_017499
TCONS_00034762 other upstream 1201064 35422698 ~ 35422827 (+) True XLOC_017490
TCONS_00034760 other upstream 1241274 35382438 ~ 35382617 (+) False XLOC_017489
TCONS_00034756 other upstream 1334920 35279996 ~ 35288971 (+) False XLOC_017488
TCONS_00034743 other upstream 1559910 35062806 ~ 35063981 (+) True XLOC_017485
TCONS_00034815 other downstream 1194457 37820990 ~ 37826136 (+) False XLOC_017519
TCONS_00034825 other downstream 1487264 38113797 ~ 38119890 (+) True XLOC_017523
TCONS_00034845 other downstream 1994133 38620666 ~ 38648890 (+) False XLOC_017535
TCONS_00034847 other downstream 1994201 38620734 ~ 38633460 (+) True XLOC_017535
TCONS_00034852 other downstream 2148439 38774972 ~ 38775087 (+) True XLOC_017538

Expression Profile

//