RNA id: TCONS_00040209


Basic Information

Item Value
RNA id TCONS_00040209
length 471
RNA type mRNA
GC content 0.50
exon number 2
gene id XLOC_020223
representative True

Chromosome Information

Item Value
chromosome id NC_007133.7
NCBI id CM002906.2
chromosome length 39133080
location 10158463 ~ 10164865 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGACATTTCTTTTAAGAAGAAGGATTTTCACACTGACGGTTCCTGCATCCTCCACAACAGGGCACAGGTCGCTTTACGTCGGTGAACAGGCCTCGCTAAGCAAAACATTCAGTGCCAGAGACGTTGCACTTTTTGCTGAGCTGACAGGGGACACAAATCCTCTCCATGTCGACCCGGAGTACGCCAAAACCACCTCTTTTGAGACCCCCATTGTTCACGGAGTGCTGATTAATGGTCTGATCTCAGCAGTTCTCGGGACGAAGTTACCCGGTAAAGGCTGCGTGTTTCTCTACCAGGAAATACGCTTCCCAGCGCCGCTCTTCATCGGAGAGGAGGTTGTGGCGGAAGCAAAGGTCAAAAAGATCAAAATGTCCTTCGCTTTTATTTCTGTTTCCTGCGCTGCCAAAGACAAAGTAGTCATGGAGGGAGAGGTCATGGTCATGATGCCGCAGAACCAACAACAAGCATGA

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0001731 formation of translation preinitiation complex biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:1901861 regulation of muscle tissue development biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:0016202 regulation of striated muscle tissue development biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0010467 gene expression biological_process
GO:0048634 regulation of muscle organ development biological_process
GO:0048641 regulation of skeletal muscle tissue development biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0044428 obsolete nuclear part cellular_component
GO:0005634 nucleus cellular_component
GO:0005730 nucleolus cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0004029 aldehyde dehydrogenase (NAD+) activity molecular_function
GO:0003723 RNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

ZFIN:

id description
ZDB-GENE-050522-182 Predicted to enable ribonuclease P activity. Predicted to act upstream of or within tRNA processing. Orthologous to human RPP14 (ribonuclease P/MRP subunit p14).

Ensembl:

ensembl_id ENSDART00000190468

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00042071 lncRNA upstream 68611 10073420 ~ 10095290 (+) False XLOC_020221
TCONS_00042072 lncRNA upstream 68611 10074865 ~ 10095290 (+) False XLOC_020221
TCONS_00042070 lncRNA upstream 114668 10018900 ~ 10049233 (+) True XLOC_020219
TCONS_00042069 lncRNA upstream 172407 9989905 ~ 9991494 (+) True XLOC_020216
TCONS_00042068 lncRNA upstream 259278 9897971 ~ 9904623 (+) True XLOC_020212
TCONS_00040213 lncRNA downstream 50593 10214994 ~ 10222660 (+) False XLOC_020226
TCONS_00042073 lncRNA downstream 52403 10216804 ~ 10222660 (+) True XLOC_020226
TCONS_00042074 lncRNA downstream 136002 10300403 ~ 10354336 (+) False XLOC_020228
TCONS_00042075 lncRNA downstream 136016 10300417 ~ 10354336 (+) False XLOC_020228
TCONS_00040216 lncRNA downstream 136125 10300526 ~ 10301424 (+) True XLOC_020228
TCONS_00040205 mRNA upstream 22432 10129788 ~ 10141469 (+) True XLOC_020222
TCONS_00040203 mRNA upstream 66674 10090673 ~ 10097227 (+) False XLOC_020221
TCONS_00040204 mRNA upstream 71199 10090841 ~ 10092702 (+) True XLOC_020221
TCONS_00040201 mRNA upstream 92605 10066846 ~ 10071296 (+) False XLOC_020220
TCONS_00040210 mRNA downstream 2006 10166407 ~ 10199014 (+) True XLOC_020224
TCONS_00040211 mRNA downstream 37425 10201826 ~ 10212502 (+) False XLOC_020225
TCONS_00040212 mRNA downstream 37470 10201871 ~ 10208546 (+) True XLOC_020225
TCONS_00040214 mRNA downstream 51157 10215558 ~ 10219216 (+) False XLOC_020226
TCONS_00040215 mRNA downstream 68126 10232527 ~ 10262441 (+) True XLOC_020227
TCONS_00040182 other upstream 374097 9787067 ~ 9789804 (+) True XLOC_020205
TCONS_00040167 other upstream 780417 9359899 ~ 9383484 (+) True XLOC_020197
TCONS_00040142 other upstream 1377608 8786167 ~ 8786293 (+) False XLOC_020180
TCONS_00040140 other upstream 1394508 8766367 ~ 8769393 (+) True XLOC_020179
TCONS_00040135 other upstream 1464668 8695096 ~ 8699233 (+) False XLOC_020176
TCONS_00040218 other downstream 329854 10494255 ~ 10513982 (+) True XLOC_020229
TCONS_00040220 other downstream 389327 10553728 ~ 10558972 (+) True XLOC_020230
TCONS_00040228 other downstream 508750 10673151 ~ 10678490 (+) False XLOC_020234
TCONS_00040250 other downstream 1498216 11662617 ~ 11674637 (+) True XLOC_020251
TCONS_00040255 other downstream 1729961 11894362 ~ 11894479 (+) True XLOC_020255

Expression Profile

//