RNA id: TCONS_00044221


Basic Information

Item Value
RNA id TCONS_00044221
length 372
RNA type mRNA
GC content 0.52
exon number 4
gene id XLOC_022413
representative True

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 27683014 ~ 27695173 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGACGCATCTGTCGAGTGCTGGGTGCCATAGCAACGCCAGCGGGCTCTCAGGAAACATAATTCCTCTTTAGTTTGTCACGTCTAAAAATCGACCGTATTTCACGACCGGAGGCTGCCGATCGGATTGCGTTGTCAGCAACGCTAGTCCTTTCGTTTGCTGCTGGTGTGATGATGAATGCTGACGATTGCAATGGCCGTTCGTACATGTCAGGTAGTGGAGATTCTTCAACAGAGCGGGAGTTTTTTGCAGGGCTGAGAGGACCCACCGTGAGCACACCAAACAGTCAACAGTCCTCACCCAGCCGCTCACTCAGTGCTAACTCCATCAAAGTGGAGCTGTATAGTGACGAGGAGGCAGGTGGTGCTCCACTA

Function

GO:

id name namespace
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0046872 metal ion binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-180319-1 Predicted to enable DNA-binding transcription factor activity and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Orthologous to human IKZF4 (IKAROS family zinc finger 4).

Ensembl:

ensembl_id ENSDART00000135129

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00045022 lncRNA downstream 13866 27652896 ~ 27675394 (-) True XLOC_022412
TCONS_00044209 lncRNA downstream 130545 27555849 ~ 27558715 (-) True XLOC_022406
TCONS_00045021 lncRNA downstream 444025 27233879 ~ 27245235 (-) True XLOC_022399
TCONS_00044738 lncRNA downstream 490165 27191956 ~ 27199095 (-) True XLOC_022400
TCONS_00044194 lncRNA downstream 566137 27113460 ~ 27123123 (-) True XLOC_022398
TCONS_00045024 lncRNA upstream 32335 27727295 ~ 27729454 (-) False XLOC_022415
TCONS_00045023 lncRNA upstream 32335 27727295 ~ 27729454 (-) True XLOC_022415
TCONS_00045025 lncRNA upstream 75521 27770481 ~ 27772372 (-) True XLOC_022416
TCONS_00045026 lncRNA upstream 93409 27788369 ~ 27795923 (-) True XLOC_022417
TCONS_00044237 lncRNA upstream 495569 28190529 ~ 28226719 (-) False XLOC_022424
TCONS_00044217 mRNA downstream 41491 27641471 ~ 27647769 (-) True XLOC_022411
TCONS_00044216 mRNA downstream 55530 27622020 ~ 27633730 (-) True XLOC_022410
TCONS_00044215 mRNA downstream 81003 27592347 ~ 27608257 (-) True XLOC_022409
TCONS_00044214 mRNA downstream 82221 27591366 ~ 27607039 (-) False XLOC_022409
TCONS_00044213 mRNA downstream 99506 27582924 ~ 27589754 (-) True XLOC_022407
TCONS_00044222 mRNA upstream 1734 27696694 ~ 27702561 (-) False XLOC_022414
TCONS_00044224 mRNA upstream 2096 27697056 ~ 27701361 (-) False XLOC_022414
TCONS_00044223 mRNA upstream 2096 27697056 ~ 27701361 (-) True XLOC_022414
TCONS_00044225 mRNA upstream 105559 27800519 ~ 27822920 (-) False XLOC_022418
TCONS_00044227 mRNA upstream 140687 27835647 ~ 27857051 (-) False XLOC_022419
TCONS_00044212 other downstream 108968 27580164 ~ 27580292 (-) True XLOC_022408
TCONS_00044197 other downstream 453606 27206719 ~ 27235654 (-) False XLOC_022399
TCONS_00044183 other downstream 867492 26819114 ~ 26821768 (-) True XLOC_022395
TCONS_00044178 other downstream 1013490 26675652 ~ 26675770 (-) True XLOC_022392
TCONS_00044148 other downstream 1896279 25789132 ~ 25792981 (-) False XLOC_022380
TCONS_00044226 other upstream 114108 27809068 ~ 27822778 (-) True XLOC_022418
TCONS_00044236 other upstream 495569 28190529 ~ 28222959 (-) False XLOC_022424
TCONS_00044238 other upstream 506000 28200960 ~ 28223243 (-) True XLOC_022424
TCONS_00044248 other upstream 1490892 29185852 ~ 29257404 (-) False XLOC_022432
TCONS_00044249 other upstream 1490892 29185852 ~ 29257561 (-) False XLOC_022432

Expression Profile

//