RNA id: TCONS_00051787


Basic Information

Item Value
RNA id TCONS_00051787
length 334
RNA type processed_transcript
GC content 0.46
exon number 2
gene id XLOC_026582
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 34688022 ~ 34753605 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CGTGTATTTTCCTGTTGTGGCAGCCGAAACCGAATCGTTTTCAAACGTGGTCAAACAAATAACATACTAACACTTTCCTTCTAAGTGGATATAATCCGAACATAGGCTATTATTTTAAGTAGTTCTTAGCGGTTTGGAAGGGTATCGCAGCGCGCCGAGCGGGCGACTCGCGACGAAGAAGACCGCTCGTTAAGGAGACTGCTGGTGGGACTTCAATGTACCATTTCGCGTTGTTTTGGAAGCAGTTTGTGTTTCTTCGTAAGGAAGTGGGTTAACTTCCATTGGCTGTGGAGGTGAATCTGACAGCTCGCATAATTCCATGCCCATTCACAGC

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0030154 cell differentiation biological_process
GO:0021591 ventricular system development biological_process
GO:0007275 multicellular organism development biological_process
GO:0000122 negative regulation of transcription by RNA polymerase II biological_process
GO:0045892 negative regulation of transcription, DNA-templated biological_process
GO:0045893 positive regulation of transcription, DNA-templated biological_process
GO:0014032 neural crest cell development biological_process
GO:0002154 thyroid hormone mediated signaling pathway biological_process
GO:0009725 response to hormone biological_process
GO:0045944 positive regulation of transcription by RNA polymerase II biological_process
GO:0009755 hormone-mediated signaling pathway biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0005515 protein binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0004879 nuclear receptor activity molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0003707 steroid hormone receptor activity molecular_function
GO:0008270 zinc ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-990415-263 Enables nuclear receptor activity. Involved in negative regulation of transcription by RNA polymerase II and positive regulation of transcription by RNA polymerase II. Acts upstream of or within several processes, including neural crest cell development; thyroid hormone mediated signaling pathway; and ventricular system development. Located in nucleus. Is expressed in several structures, including blastodisc; muscle; nervous system; optic cup; and pleuroperitoneal region. Used to study hypothyroidism. Human ortholog(s) of this gene implicated in congenital nongoitrous hypothyroidism 6 and renal cell carcinoma. Orthologous to human THRA (thyroid hormone receptor alpha).

Ensembl:

ensembl_id ENSDART00000151633

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00051786 lncRNA downstream 36842 34701214 ~ 34706737 (-) False XLOC_026582
TCONS_00052477 lncRNA downstream 88471 34653587 ~ 34655108 (-) True XLOC_026581
TCONS_00052476 lncRNA downstream 101606 34641048 ~ 34641973 (-) True XLOC_026580
TCONS_00051776 lncRNA downstream 150523 34591917 ~ 34593056 (-) True XLOC_026576
TCONS_00051773 lncRNA downstream 197173 34525942 ~ 34546406 (-) False XLOC_026575
TCONS_00051790 lncRNA upstream 14000 34767541 ~ 34778787 (-) True XLOC_026583
TCONS_00053067 lncRNA upstream 48458 34801999 ~ 34804718 (-) False XLOC_026584
TCONS_00051793 lncRNA upstream 48458 34801999 ~ 34806079 (-) False XLOC_026584
TCONS_00053068 lncRNA upstream 193861 34947402 ~ 34948061 (-) False XLOC_026585
TCONS_00053069 lncRNA upstream 811587 35565128 ~ 35574451 (-) True XLOC_026588
TCONS_00051785 mRNA downstream 18700 34697821 ~ 34724879 (-) False XLOC_026582
TCONS_00051783 mRNA downstream 25697 34688022 ~ 34717882 (-) False XLOC_026582
TCONS_00051780 mRNA downstream 86834 34652144 ~ 34656745 (-) False XLOC_026581
TCONS_00051779 mRNA downstream 118834 34623560 ~ 34624745 (-) True XLOC_026579
TCONS_00051778 mRNA downstream 130478 34601852 ~ 34613101 (-) True XLOC_026578
TCONS_00051788 mRNA upstream 13448 34766989 ~ 34801041 (-) False XLOC_026583
TCONS_00051791 mRNA upstream 47605 34801146 ~ 34816979 (-) False XLOC_026584
TCONS_00051792 mRNA upstream 50407 34803948 ~ 34816893 (-) False XLOC_026584
TCONS_00051796 mRNA upstream 781580 35535121 ~ 35541381 (-) False XLOC_026586
TCONS_00051797 mRNA upstream 782439 35535980 ~ 35541378 (-) True XLOC_026586
TCONS_00051781 other downstream 86842 34652310 ~ 34656737 (-) False XLOC_026581
TCONS_00051782 other downstream 88581 34652972 ~ 34654998 (-) False XLOC_026581
TCONS_00051772 other downstream 197180 34525942 ~ 34546399 (-) False XLOC_026575
TCONS_00051752 other downstream 640214 34102957 ~ 34103365 (-) True XLOC_026563
TCONS_00051740 other downstream 657096 34086041 ~ 34086483 (-) True XLOC_026558
TCONS_00051789 other upstream 14000 34767541 ~ 34775954 (-) False XLOC_026583
TCONS_00051794 other upstream 52298 34805839 ~ 34813969 (-) True XLOC_026584
TCONS_00051795 other upstream 194097 34947638 ~ 34948034 (-) True XLOC_026585
TCONS_00051816 other upstream 1480666 36234207 ~ 36239041 (-) False XLOC_026597
TCONS_00051818 other upstream 1486771 36240312 ~ 36246722 (-) False XLOC_026597

Expression Profile

//