RNA id: TCONS_00051752


Basic Information

Item Value
RNA id TCONS_00051752
length 336
RNA type IG_V_pseudogene
GC content 0.42
exon number 2
gene id XLOC_026563
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 34095514 ~ 34103365 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGAAGAATGCTCTCTGCTTACTGCTGCTCTCATTCAGTCTACAGTGTTTAAAATGTCAAAGTATGGAGTCGATTGAAAGCTCAGTTCAGAGAAAGCCTGGAGAAACTCTGACTCTGTCCTGTAGAGGATCTGGGTTGACGTTTAGCTCCTATTACATGAACTGGATCAGACAACAAGCTGGAAAACCTCTTGTGTGGATTGGATACACTGGCCAATATGCTGAATCCTTCAAAAGAAGAGCTGAAATCACCAGAGATAATTCAAGAGTATGACATATCTGAAACTATCAGGCCTGACAGCAGAAGATTCAGCCGTGTATTACTGTGCAAGACAAT

Function

GO:

id name namespace
GO:0045087 innate immune response biological_process
GO:0050871 positive regulation of B cell activation biological_process
GO:0006910 phagocytosis, recognition biological_process
GO:0006911 phagocytosis, engulfment biological_process
GO:0042742 defense response to bacterium biological_process
GO:0006958 complement activation, classical pathway biological_process
GO:0050853 B cell receptor signaling pathway biological_process
GO:0009897 external side of plasma membrane cellular_component
GO:0042571 immunoglobulin complex, circulating cellular_component
GO:0034987 immunoglobulin receptor binding molecular_function
GO:0003823 antigen binding molecular_function

KEGG: NA

Ensembl:

ensembl_id ENSDART00000138092

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00051677 lncRNA downstream 164136 33936453 ~ 33938821 (-) True XLOC_026512
TCONS_00051675 lncRNA downstream 167519 33922620 ~ 33935438 (-) False XLOC_026512
TCONS_00053065 lncRNA downstream 183762 33918566 ~ 33919195 (-) True XLOC_026511
TCONS_00051667 lncRNA downstream 412203 33681518 ~ 33690754 (-) True XLOC_026509
TCONS_00051659 lncRNA downstream 665225 33435754 ~ 33437732 (-) True XLOC_026506
TCONS_00053066 lncRNA upstream 36272 34139637 ~ 34141181 (-) True XLOC_026572
TCONS_00051762 lncRNA upstream 76442 34179807 ~ 34180432 (-) False XLOC_026573
TCONS_00051763 lncRNA upstream 76442 34179807 ~ 34180451 (-) True XLOC_026573
TCONS_00051771 lncRNA upstream 366789 34470154 ~ 34477363 (-) False XLOC_026575
TCONS_00051773 lncRNA upstream 422577 34525942 ~ 34546406 (-) False XLOC_026575
TCONS_00051751 mRNA downstream 882 34101631 ~ 34102075 (-) True XLOC_026566
TCONS_00051750 mRNA downstream 2257 34100272 ~ 34100700 (-) False XLOC_026563
TCONS_00051749 mRNA downstream 4226 34098259 ~ 34098731 (-) True XLOC_026565
TCONS_00051748 mRNA downstream 5970 34096513 ~ 34096987 (-) True XLOC_026564
TCONS_00051683 mRNA downstream 7736 33965579 ~ 34095221 (-) False XLOC_026515
TCONS_00051753 mRNA upstream 2681 34106046 ~ 34106471 (-) True XLOC_026567
TCONS_00051754 mRNA upstream 3832 34107197 ~ 34107685 (-) True XLOC_026568
TCONS_00051755 mRNA upstream 10045 34113410 ~ 34113838 (-) True XLOC_026569
TCONS_00051756 mRNA upstream 12073 34115438 ~ 34115886 (-) True XLOC_026570
TCONS_00051757 mRNA upstream 26140 34129505 ~ 34136778 (-) False XLOC_026571
TCONS_00051740 other downstream 16474 34086041 ~ 34086483 (-) True XLOC_026558
TCONS_00051725 other downstream 38021 34063955 ~ 34064936 (-) True XLOC_026547
TCONS_00051722 other downstream 44240 34058679 ~ 34058717 (-) True XLOC_026544
TCONS_00051716 other downstream 54304 34048205 ~ 34048653 (-) True XLOC_026539
TCONS_00051715 other downstream 55341 34047179 ~ 34047616 (-) True XLOC_026538
TCONS_00051772 other upstream 422577 34525942 ~ 34546399 (-) False XLOC_026575
TCONS_00051781 other upstream 548945 34652310 ~ 34656737 (-) False XLOC_026581
TCONS_00051782 other upstream 549607 34652972 ~ 34654998 (-) False XLOC_026581
TCONS_00051787 other upstream 640214 34743579 ~ 34753541 (-) True XLOC_026582
TCONS_00051789 other upstream 664176 34767541 ~ 34775954 (-) False XLOC_026583

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
striped catfish (Pangasianodon hypophthalmus) LOC117598907 True 414 V_segment 0.43 2 NC_047607.1 22231972 ~ 22232468 (-)