RNA id: TCONS_00058501


Basic Information

Item Value
RNA id TCONS_00058501
length 153
RNA type mRNA
GC content 0.42
exon number 1
gene id XLOC_029817
representative True

Chromosome Information

Item Value
chromosome id NC_007116.7
NCBI id CM002889.2
chromosome length 72500376
location 4366431 ~ 4374375 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTTTAGACTTGATGTAATTCCGCACCGACAGGGTGAGAAACCCAGAGTTTCTGCTGAGGGTCTCCCTCTGAAAACCGATGAAGAAACACATCTTACTGCTTTTCACATACCGAGGACTAGTAAGAAAAGGGAAAAAGAGTAAAAGAAGAAAAT

Function

GO:

id name namespace
GO:0032918 spermidine acetylation biological_process
GO:0005575 cellular_component cellular_component
GO:0019809 spermidine binding molecular_function
GO:0016740 transferase activity molecular_function
GO:0008080 N-acetyltransferase activity molecular_function
GO:0004145 diamine N-acetyltransferase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040704-4 Enables diamine N-acetyltransferase activity. Predicted to be involved in spermidine acetylation. Is expressed in several structures, including digestive system; eye; gill; heart; and pleuroperitoneal region. Orthologous to human SAT1 (spermidine/spermine N1-acetyltransferase 1).

Ensembl:

ensembl_id ENSDART00000149185

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00058496 lncRNA upstream 30983 4332220 ~ 4335463 (+) False XLOC_029816
TCONS_00058493 lncRNA upstream 317350 4046771 ~ 4049096 (+) True XLOC_029813
TCONS_00061618 lncRNA upstream 338568 4016371 ~ 4027878 (+) False XLOC_029813
TCONS_00061620 lncRNA downstream 542756 4909354 ~ 4914933 (+) False XLOC_029823
TCONS_00061621 lncRNA downstream 543088 4909686 ~ 4912079 (+) True XLOC_029823
TCONS_00061622 lncRNA downstream 796665 5163263 ~ 5171332 (+) False XLOC_029824
TCONS_00061623 lncRNA downstream 796667 5163265 ~ 5171332 (+) False XLOC_029824
TCONS_00061627 lncRNA downstream 796699 5163297 ~ 5171332 (+) False XLOC_029824
TCONS_00058499 mRNA upstream 23580 4338874 ~ 4342866 (+) True XLOC_029816
TCONS_00058498 mRNA upstream 23651 4332220 ~ 4342795 (+) False XLOC_029816
TCONS_00058495 mRNA upstream 47757 4298636 ~ 4318689 (+) True XLOC_029815
TCONS_00058494 mRNA upstream 223491 4054704 ~ 4142955 (+) True XLOC_029814
TCONS_00058489 mRNA upstream 317231 4016301 ~ 4049215 (+) False XLOC_029813
TCONS_00058502 mRNA downstream 69807 4436405 ~ 4470474 (+) True XLOC_029818
TCONS_00058503 mRNA downstream 166646 4533244 ~ 4547917 (+) True XLOC_029819
TCONS_00058504 mRNA downstream 197635 4564233 ~ 4571382 (+) True XLOC_029820
TCONS_00058505 mRNA downstream 209202 4575800 ~ 4579408 (+) True XLOC_029821
TCONS_00058506 mRNA downstream 440253 4806851 ~ 4830356 (+) True XLOC_029822
TCONS_00058497 other upstream 23679 4332220 ~ 4342767 (+) False XLOC_029816
TCONS_00058487 other upstream 338568 4016273 ~ 4027878 (+) False XLOC_029813
TCONS_00058491 other upstream 341457 4016994 ~ 4024989 (+) False XLOC_029813
TCONS_00058490 other upstream 341489 4016371 ~ 4024957 (+) False XLOC_029813
TCONS_00058477 other upstream 1195620 3170736 ~ 3170826 (+) True XLOC_029807
TCONS_00058507 other downstream 985473 5352071 ~ 5352187 (+) True XLOC_029826
TCONS_00058510 other downstream 1248733 5615331 ~ 5615446 (+) True XLOC_029828
TCONS_00058515 other downstream 2332522 6699120 ~ 6705073 (+) True XLOC_029832
TCONS_00058523 other downstream 2491541 6858139 ~ 6863720 (+) True XLOC_029836
TCONS_00058525 other downstream 2509322 6875920 ~ 6876034 (+) True XLOC_029838

Expression Profile

//