RNA id: TCONS_00059993


Basic Information

Item Value
RNA id TCONS_00059993
length 348
RNA type processed_transcript
GC content 0.52
exon number 2
gene id XLOC_030847
representative False

Chromosome Information

Item Value
chromosome id NC_007116.7
NCBI id CM002889.2
chromosome length 72500376
location 9179578 ~ 9216758 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTCCAGTGCAGTGCGGCGAGTACCAGTTTTCCTGCTCCTCCAAAACTCAGTGTATCCCTCAATCCTGGCGCTGTGATGGGTCTGAAGACTGCAGGGATGGCAGTGACGAATCTGCTTCAATAACTTGATGTGCAGTAATAGTACTGCTCTGGTCTGTGTTTGATCAGGTGCAAGTGTGTCCTGTCCTCCCCACCTCTTCCAGTGTGGGAGTTCGGAGTGTGTGGAGTTTTCTCAACTCTGTAATGGAGTCACCAACTGTCTGGACGGGTCAGATGAGGGCGGCTCCTGTCAGACTGAGAAATGCTCTGAACAGTTAAAGTGTGCCCAAGACTGCCACAGCACACCTGC

Function

GO:

id name namespace
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005509 calcium ion binding molecular_function
GO:0003824 catalytic activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-130729-1 Predicted to enable calcium ion binding activity and catalytic activity. Predicted to act upstream of or within endocytosis. Predicted to be located in membrane. Predicted to be integral component of membrane.

Ensembl:

ensembl_id ENSDART00000132159

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00061518 lncRNA downstream 56946 9144367 ~ 9146777 (-) False XLOC_030844
TCONS_00061519 lncRNA downstream 56946 9144457 ~ 9146777 (-) True XLOC_030844
TCONS_00061937 lncRNA downstream 76164 9107085 ~ 9127559 (-) True XLOC_030843
TCONS_00061517 lncRNA downstream 171972 9030240 ~ 9031751 (-) True XLOC_030840
TCONS_00059986 lncRNA downstream 239948 8959728 ~ 8963775 (-) True XLOC_030839
TCONS_00061520 lncRNA upstream 674297 9880188 ~ 9882404 (-) True XLOC_030853
TCONS_00061938 lncRNA upstream 1009623 10215514 ~ 10217606 (-) True XLOC_030859
TCONS_00060011 lncRNA upstream 1283046 10488937 ~ 10500684 (-) False XLOC_030861
TCONS_00061521 lncRNA upstream 1283103 10488994 ~ 10495826 (-) False XLOC_030861
TCONS_00061939 lncRNA upstream 1291580 10497471 ~ 10500797 (-) False XLOC_030861
TCONS_00059988 mRNA downstream 113545 9078198 ~ 9090178 (-) True XLOC_030842
TCONS_00059987 mRNA downstream 130290 9070382 ~ 9073433 (-) True XLOC_030841
TCONS_00059984 mRNA downstream 293020 8832299 ~ 8910703 (-) False XLOC_030838
TCONS_00059985 mRNA downstream 295904 8891244 ~ 8907819 (-) True XLOC_030838
TCONS_00059983 mRNA downstream 385882 8769069 ~ 8817841 (-) True XLOC_030837
TCONS_00059994 mRNA upstream 1170 9207061 ~ 9216758 (-) True XLOC_030847
TCONS_00059995 mRNA upstream 235307 9441198 ~ 9540641 (-) False XLOC_030848
TCONS_00059996 mRNA upstream 239248 9445139 ~ 9540770 (-) True XLOC_030848
TCONS_00059997 mRNA upstream 351052 9556943 ~ 9580837 (-) False XLOC_030849
TCONS_00059998 mRNA upstream 351052 9556943 ~ 9625459 (-) True XLOC_030849
TCONS_00059992 other downstream 16817 9179822 ~ 9186906 (-) False XLOC_030847
TCONS_00059990 other downstream 24287 9173538 ~ 9179436 (-) True XLOC_030846
TCONS_00059989 other downstream 33189 9166395 ~ 9170534 (-) True XLOC_030845
TCONS_00059982 other downstream 480680 8722928 ~ 8723043 (-) True XLOC_030836
TCONS_00059979 other downstream 521352 8678463 ~ 8682371 (-) True XLOC_030833
TCONS_00060013 other upstream 1301935 10507826 ~ 10508814 (-) True XLOC_030862
TCONS_00060014 other upstream 1515003 10720894 ~ 10724665 (-) True XLOC_030863
TCONS_00060031 other upstream 2776473 11982364 ~ 12031921 (-) False XLOC_030876
TCONS_00060039 other upstream 2987007 12192898 ~ 12193014 (-) True XLOC_030880
TCONS_00060044 other upstream 3147830 12353721 ~ 12372897 (-) False XLOC_030879

Expression Profile

//