RNA id: TCONS_00068552


Basic Information

Item Value
RNA id TCONS_00068552
length 1066
lncRNA type inter_gene
GC content 0.47
exon number 2
gene id XLOC_033467
representative True

Chromosome Information

Item Value
chromosome id NC_007118.7
NCBI id CM002891.2
chromosome length 74282399
location 9061425 ~ 9063381 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

caaaagtctgagcaaaacctcgtggcgtgctgctgcagtttgattcggatctttagaggcttcttgattcacaactcgtttgaatcaacgaatcagtaggcgcgtacctgaagtgatacaatatcgcgagatggattcaaatgcacacggagctgtctgttgttctcgcgatgttttgatgtcacactgatcggtttgttgaagacgaatcgattcaactctccgtcctccattcccagaatttcctgttcacggcagtacaaggacggcagcgcgagagcagcaagacccatgggatttcatcagccactcaccatcagagtcctcagtggaagctgagaagagcagaagaggaagccaagcaagagatgccagaaaaaaagggggaaggaaataatgtgttattttgctgtttgagtataggcaggcgcagtgggtagcacaatcgcctcacagcaagaaggtcgctggttcgagcctcggctgggtcagttggcatttatgtgtggagtttgcatgttctccccatgttagcgtgggtttcctccgggtgctcccacaagtccaaaaatatgtggtgacattgggtaaggtaaaattgtccgtagtgtatgtgtgtgaatgagtatgtatggatgtttcccagtgatgggttgcagctgggtggcaacacggtggcacagtaggtagtgctgtttcctcacatcaagaaggtttctgcatggagttctccctgcgttcgcgtgggtttcctccgggtgctccggtttccctcacagtccaaagacatgcggtacaggggaattgggtagactaaattgtccgtagtgaatgcgtgtgagtgagtgtgtatggatgtttcccagagatgggttgcagctggaagggcatccactgcgtaaaacatatgctggataagatggtggtttattccactgtggcgaccccagattaacaaaaggacaaagccgaagagaaaatgaatgagtataggcaatgatagacaagacaatgtttgattaatatgaagtcttttaaaatgcttatttattaaaataaaggttac

Function

GO:

id name namespace
GO:0045995 regulation of embryonic development biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0065007 biological regulation biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0043009 chordate embryonic development biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0003146 heart jogging biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0060429 epithelium development biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0048562 embryonic organ morphogenesis biological_process
GO:1903225 negative regulation of endodermal cell differentiation biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0010468 regulation of gene expression biological_process
GO:0009952 anterior/posterior pattern specification biological_process
GO:0007369 gastrulation biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0003002 regionalization biological_process
GO:0007389 pattern specification process biological_process
GO:0050789 regulation of biological process biological_process
GO:0061053 somite development biological_process
GO:0050794 regulation of cellular process biological_process
GO:0060795 cell fate commitment involved in formation of primary germ layer biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0007420 brain development biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0060562 epithelial tube morphogenesis biological_process
GO:0042664 negative regulation of endodermal cell fate specification biological_process
GO:0009790 embryo development biological_process
GO:0009792 embryo development ending in birth or egg hatching biological_process
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko03070 Bacterial secretion system
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00068777 lncRNA upstream 220810 8835309 ~ 8840615 (+) False XLOC_033465
TCONS_00068778 lncRNA upstream 220810 8835313 ~ 8840615 (+) False XLOC_033465
TCONS_00068779 lncRNA upstream 220810 8835334 ~ 8840615 (+) True XLOC_033465
TCONS_00065495 lncRNA upstream 434741 8623945 ~ 8626684 (+) True XLOC_033463
TCONS_00068551 lncRNA upstream 690664 8370122 ~ 8370761 (+) True XLOC_033459
TCONS_00065504 lncRNA downstream 236259 9299640 ~ 9305581 (+) False XLOC_033469
TCONS_00065505 lncRNA downstream 239229 9302610 ~ 9305581 (+) True XLOC_033469
TCONS_00068553 lncRNA downstream 492663 9556044 ~ 9556645 (+) True XLOC_033472
TCONS_00068780 lncRNA downstream 989962 10053343 ~ 10054205 (+) True XLOC_033476
TCONS_00068554 lncRNA downstream 1498737 10562118 ~ 10583144 (+) False XLOC_033479
TCONS_00065499 mRNA upstream 15126 9041174 ~ 9046299 (+) False XLOC_033466
TCONS_00065498 mRNA upstream 15654 9008372 ~ 9045771 (+) False XLOC_033466
TCONS_00065496 mRNA upstream 380243 8670398 ~ 8681182 (+) False XLOC_033464
TCONS_00065494 mRNA upstream 516570 8543317 ~ 8544855 (+) True XLOC_033462
TCONS_00065493 mRNA upstream 602963 8456999 ~ 8458462 (+) True XLOC_033461
TCONS_00065501 mRNA downstream 126166 9189547 ~ 9273323 (+) True XLOC_033468
TCONS_00065502 mRNA downstream 227548 9290929 ~ 9305579 (+) False XLOC_033469
TCONS_00065506 mRNA downstream 245244 9308625 ~ 9322493 (+) True XLOC_033470
TCONS_00065507 mRNA downstream 262853 9326234 ~ 9511298 (+) True XLOC_033471
TCONS_00065508 mRNA downstream 810369 9873750 ~ 9895905 (+) False XLOC_033473
TCONS_00065500 other upstream 15123 9041175 ~ 9046302 (+) True XLOC_033466
TCONS_00065497 other upstream 380244 8670465 ~ 8681181 (+) True XLOC_033464
TCONS_00065492 other upstream 631506 8428954 ~ 8429919 (+) True XLOC_033460
TCONS_00065484 other upstream 1282249 7778963 ~ 7779176 (+) True XLOC_033454
TCONS_00065483 other upstream 1289047 7772165 ~ 7772378 (+) True XLOC_033453
TCONS_00065503 other downstream 227584 9290965 ~ 9305581 (+) False XLOC_033469
TCONS_00065516 other downstream 1184691 10248072 ~ 10248187 (+) True XLOC_033477
TCONS_00065522 other downstream 1514968 10578349 ~ 10582625 (+) True XLOC_033479
TCONS_00065525 other downstream 1620106 10683487 ~ 10683607 (+) True XLOC_033482
TCONS_00065536 other downstream 2150027 11213408 ~ 11213524 (+) True XLOC_033487

Expression Profile

//