RNA id: TCONS_00070978


Basic Information

Item Value
RNA id TCONS_00070978
length 81
RNA type snoRNA
GC content 0.44
exon number 1
gene id XLOC_036322
representative False

Chromosome Information

Item Value
chromosome id NC_007119.7
NCBI id CM002892.2
chromosome length 54304671
location 16609622 ~ 16613663 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGCAGATGATGACTGCATAGTTCAGCAGAAACTCCATGTAGAACACAGAGCAATGTCTTTCGCTCCTAGCTGATGCATCA

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0048732 gland development biological_process
GO:0016070 RNA metabolic process biological_process
GO:0016072 rRNA metabolic process biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0071840 cellular component organization or biogenesis biological_process
GO:0007517 muscle organ development biological_process
GO:0034470 ncRNA processing biological_process
GO:0006364 rRNA processing biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0031290 retinal ganglion cell axon guidance biological_process
GO:0006396 RNA processing biological_process
GO:0030490 maturation of SSU-rRNA biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0010467 gene expression biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) biological_process
GO:0000463 maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) biological_process
GO:0000469 cleavage involved in rRNA processing biological_process
GO:0000470 maturation of LSU-rRNA biological_process
GO:0042273 ribosomal large subunit biogenesis biological_process
GO:0042274 ribosomal small subunit biogenesis biological_process
GO:0000478 endonucleolytic cleavage involved in rRNA processing biological_process
GO:0000479 endonucleolytic cleavage of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) biological_process
GO:0061053 somite development biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0034660 ncRNA metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0090501 RNA phosphodiester bond hydrolysis biological_process
GO:0090502 RNA phosphodiester bond hydrolysis, endonucleolytic biological_process
GO:0030684 preribosome cellular_component
GO:0030686 90S preribosome cellular_component
GO:0032040 small-subunit processome cellular_component
GO:0044422 obsolete organelle part cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0044428 obsolete nuclear part cellular_component
GO:0070013 intracellular organelle lumen cellular_component
GO:0044446 obsolete intracellular organelle part cellular_component
GO:0005634 nucleus cellular_component
GO:0031974 membrane-enclosed lumen cellular_component
GO:0031981 nuclear lumen cellular_component
GO:0043228 non-membrane-bounded organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043232 intracellular non-membrane-bounded organelle cellular_component
GO:0043233 organelle lumen cellular_component
GO:0005730 nucleolus cellular_component
GO:0034511 U3 snoRNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0030515 snoRNA binding molecular_function
GO:0003723 RNA binding molecular_function

KEGG:

id description
ko00240 Pyrimidine metabolism
ko03020 RNA polymerase
ko03230 Viral genome structure
ko05164 Influenza A
ko05016 Huntington disease
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000117793

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00070971 lncRNA downstream 50 16609831 ~ 16611064 (-) False XLOC_036322
TCONS_00072019 lncRNA downstream 50 16609937 ~ 16611064 (-) False XLOC_036322
TCONS_00072413 lncRNA downstream 26502 16566548 ~ 16584612 (-) True XLOC_036318
TCONS_00072416 lncRNA downstream 33364 16570519 ~ 16577750 (-) True XLOC_036319
TCONS_00072415 lncRNA downstream 33367 16570519 ~ 16577747 (-) False XLOC_036319
TCONS_00070981 lncRNA upstream 277 16611471 ~ 16613457 (-) False XLOC_036322
TCONS_00072020 lncRNA upstream 1048403 17659597 ~ 17661194 (-) False XLOC_036335
TCONS_00071009 lncRNA upstream 1048991 17660185 ~ 17661172 (-) True XLOC_036335
TCONS_00072021 lncRNA upstream 1166666 17777860 ~ 17782923 (-) False XLOC_036336
TCONS_00071010 lncRNA upstream 1166666 17777860 ~ 17784911 (-) False XLOC_036336
TCONS_00070968 mRNA downstream 2110 16597139 ~ 16609004 (-) True XLOC_036321
TCONS_00070967 mRNA downstream 18623 16582339 ~ 16592491 (-) True XLOC_036320
TCONS_00070965 mRNA downstream 51873 16519212 ~ 16559241 (-) True XLOC_036316
TCONS_00070964 mRNA downstream 51933 16514830 ~ 16559181 (-) False XLOC_036316
TCONS_00070963 mRNA downstream 95987 16486296 ~ 16515127 (-) False XLOC_036316
TCONS_00070986 mRNA upstream 4604 16615798 ~ 16674584 (-) False XLOC_036324
TCONS_00070987 mRNA upstream 5660 16616854 ~ 16675464 (-) False XLOC_036324
TCONS_00070988 mRNA upstream 19288 16630482 ~ 16650595 (-) False XLOC_036324
TCONS_00070991 mRNA upstream 42625 16653819 ~ 16674006 (-) True XLOC_036324
TCONS_00070992 mRNA upstream 77176 16688370 ~ 16697912 (-) False XLOC_036325
TCONS_00070975 other downstream 795 16610248 ~ 16610319 (-) False XLOC_036322
TCONS_00070966 other downstream 44635 16565837 ~ 16566479 (-) True XLOC_036317
TCONS_00070956 other downstream 694787 15916210 ~ 15916327 (-) True XLOC_036309
TCONS_00070954 other downstream 978267 15632732 ~ 15632847 (-) True XLOC_036307
TCONS_00070951 other downstream 1305591 15292367 ~ 15305523 (-) True XLOC_036304
TCONS_00070980 other upstream 133 16611327 ~ 16611411 (-) False XLOC_036322
TCONS_00070982 other upstream 472 16611666 ~ 16611747 (-) False XLOC_036322
TCONS_00070983 other upstream 741 16611935 ~ 16612017 (-) True XLOC_036323
TCONS_00070984 other upstream 1614 16612808 ~ 16612881 (-) False XLOC_036322
TCONS_00070985 other upstream 1835 16613029 ~ 16613109 (-) True XLOC_036322