RNA id: TCONS_00070975


Basic Information

Item Value
RNA id TCONS_00070975
length 72
RNA type snoRNA
GC content 0.38
exon number 1
gene id XLOC_036322
representative False

Chromosome Information

Item Value
chromosome id NC_007119.7
NCBI id CM002892.2
chromosome length 54304671
location 16609622 ~ 16613663 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AACCTGTGATGAAATGATTCTGCCAAATGAATCCTAATGATTATACCCCAACCGTTCCATATTTCTGAGGTT

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0048732 gland development biological_process
GO:0016070 RNA metabolic process biological_process
GO:0016072 rRNA metabolic process biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0071840 cellular component organization or biogenesis biological_process
GO:0007517 muscle organ development biological_process
GO:0034470 ncRNA processing biological_process
GO:0006364 rRNA processing biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0031290 retinal ganglion cell axon guidance biological_process
GO:0006396 RNA processing biological_process
GO:0030490 maturation of SSU-rRNA biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0010467 gene expression biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) biological_process
GO:0000463 maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) biological_process
GO:0000469 cleavage involved in rRNA processing biological_process
GO:0000470 maturation of LSU-rRNA biological_process
GO:0042273 ribosomal large subunit biogenesis biological_process
GO:0042274 ribosomal small subunit biogenesis biological_process
GO:0000478 endonucleolytic cleavage involved in rRNA processing biological_process
GO:0000479 endonucleolytic cleavage of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) biological_process
GO:0061053 somite development biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0034660 ncRNA metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0090501 RNA phosphodiester bond hydrolysis biological_process
GO:0090502 RNA phosphodiester bond hydrolysis, endonucleolytic biological_process
GO:0030684 preribosome cellular_component
GO:0030686 90S preribosome cellular_component
GO:0032040 small-subunit processome cellular_component
GO:0044422 obsolete organelle part cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0044428 obsolete nuclear part cellular_component
GO:0070013 intracellular organelle lumen cellular_component
GO:0044446 obsolete intracellular organelle part cellular_component
GO:0005634 nucleus cellular_component
GO:0031974 membrane-enclosed lumen cellular_component
GO:0031981 nuclear lumen cellular_component
GO:0043228 non-membrane-bounded organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043232 intracellular non-membrane-bounded organelle cellular_component
GO:0043233 organelle lumen cellular_component
GO:0005730 nucleolus cellular_component
GO:0034511 U3 snoRNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0030515 snoRNA binding molecular_function
GO:0003723 RNA binding molecular_function

KEGG:

id description
ko00240 Pyrimidine metabolism
ko03020 RNA polymerase
ko03230 Viral genome structure
ko05164 Influenza A
ko05016 Huntington disease
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000127097

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00072413 lncRNA downstream 25636 16566548 ~ 16584612 (-) True XLOC_036318
TCONS_00072416 lncRNA downstream 32498 16570519 ~ 16577750 (-) True XLOC_036319
TCONS_00072415 lncRNA downstream 32501 16570519 ~ 16577747 (-) False XLOC_036319
TCONS_00072414 lncRNA downstream 32506 16570519 ~ 16577742 (-) False XLOC_036319
TCONS_00072412 lncRNA downstream 341301 16263930 ~ 16268947 (-) True XLOC_036313
TCONS_00070976 lncRNA upstream 536 16610855 ~ 16612691 (-) False XLOC_036322
TCONS_00070977 lncRNA upstream 679 16610998 ~ 16612967 (-) False XLOC_036322
TCONS_00070979 lncRNA upstream 817 16611136 ~ 16612110 (-) False XLOC_036322
TCONS_00070981 lncRNA upstream 1152 16611471 ~ 16613457 (-) False XLOC_036322
TCONS_00072020 lncRNA upstream 1049278 17659597 ~ 17661194 (-) False XLOC_036335
TCONS_00070968 mRNA downstream 1244 16597139 ~ 16609004 (-) True XLOC_036321
TCONS_00070967 mRNA downstream 17757 16582339 ~ 16592491 (-) True XLOC_036320
TCONS_00070965 mRNA downstream 51007 16519212 ~ 16559241 (-) True XLOC_036316
TCONS_00070964 mRNA downstream 51067 16514830 ~ 16559181 (-) False XLOC_036316
TCONS_00070961 mRNA downstream 95121 16470358 ~ 16515127 (-) False XLOC_036316
TCONS_00070986 mRNA upstream 5479 16615798 ~ 16674584 (-) False XLOC_036324
TCONS_00070987 mRNA upstream 6535 16616854 ~ 16675464 (-) False XLOC_036324
TCONS_00070988 mRNA upstream 20163 16630482 ~ 16650595 (-) False XLOC_036324
TCONS_00070991 mRNA upstream 43500 16653819 ~ 16674006 (-) True XLOC_036324
TCONS_00070992 mRNA upstream 78051 16688370 ~ 16697912 (-) False XLOC_036325
TCONS_00070966 other downstream 43769 16565837 ~ 16566479 (-) True XLOC_036317
TCONS_00070956 other downstream 693921 15916210 ~ 15916327 (-) True XLOC_036309
TCONS_00070954 other downstream 977401 15632732 ~ 15632847 (-) True XLOC_036307
TCONS_00070951 other downstream 1304725 15292367 ~ 15305523 (-) True XLOC_036304
TCONS_00070936 other downstream 2158465 14414353 ~ 14451783 (-) False XLOC_036294
TCONS_00070978 other upstream 795 16611114 ~ 16611194 (-) False XLOC_036322
TCONS_00070980 other upstream 1008 16611327 ~ 16611411 (-) False XLOC_036322
TCONS_00070982 other upstream 1347 16611666 ~ 16611747 (-) False XLOC_036322
TCONS_00070983 other upstream 1616 16611935 ~ 16612017 (-) True XLOC_036323
TCONS_00070984 other upstream 2489 16612808 ~ 16612881 (-) False XLOC_036322