RNA id: TCONS_00072049


Basic Information

Item Value
RNA id TCONS_00072049
length 310
lncRNA type inter_gene
GC content 0.34
exon number 2
gene id XLOC_036494
representative False

Chromosome Information

Item Value
chromosome id NC_007119.7
NCBI id CM002892.2
chromosome length 54304671
location 27183274 ~ 27201164 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

tgaagttggggtcattgtatgtggcgatctattttttacagtctatgctcgctatcccaaggttcattgcgatcccaaggttcactgcggttttccacaaggtacgtttcttacatataacgttggtcatgcattagaacaatatatacattttaagataaggaacagtgttaccagattgttgttttccacaatagaattcgtgcaaaatctttatatgatatgcaatatgcaactctaataatacaaatgtattcgtaattgtttcaatattaaagaacatcaaatgtttccaaaggtttaaaggcta

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0010467 gene expression biological_process
GO:0044238 primary metabolic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00072048 lncRNA downstream 457 27183594 ~ 27185580 (-) False XLOC_036494
TCONS_00071303 lncRNA downstream 206958 26977429 ~ 26979079 (-) True XLOC_036492
TCONS_00072470 lncRNA downstream 214911 26967436 ~ 26971126 (-) True XLOC_036491
TCONS_00071299 lncRNA downstream 462709 26722642 ~ 26723328 (-) True XLOC_036488
TCONS_00072469 lncRNA downstream 485702 26685829 ~ 26700335 (-) True XLOC_036486
TCONS_00071306 lncRNA upstream 10638 27197082 ~ 27198010 (-) False XLOC_036494
TCONS_00071307 lncRNA upstream 10638 27197082 ~ 27199090 (-) False XLOC_036494
TCONS_00072051 lncRNA upstream 10640 27197084 ~ 27199843 (-) False XLOC_036494
TCONS_00072050 lncRNA upstream 10640 27197084 ~ 27199843 (-) False XLOC_036494
TCONS_00072052 lncRNA upstream 10659 27197103 ~ 27199674 (-) False XLOC_036494
TCONS_00071301 mRNA downstream 224258 26923613 ~ 26961779 (-) False XLOC_036490
TCONS_00071302 mRNA downstream 248812 26924217 ~ 26937225 (-) True XLOC_036490
TCONS_00071300 mRNA downstream 267521 26902358 ~ 26918516 (-) True XLOC_036489
TCONS_00071298 mRNA downstream 393125 26714532 ~ 26792912 (-) False XLOC_036488
TCONS_00071297 mRNA downstream 482802 26702679 ~ 26703235 (-) True XLOC_036487
TCONS_00071313 mRNA upstream 175243 27361687 ~ 27515540 (-) False XLOC_036496
TCONS_00071316 mRNA upstream 444248 27630692 ~ 27656765 (-) True XLOC_036499
TCONS_00071317 mRNA upstream 472800 27659244 ~ 27687095 (-) True XLOC_036500
TCONS_00071319 mRNA upstream 636568 27823012 ~ 27858458 (-) False XLOC_036502
TCONS_00071321 mRNA upstream 636857 27823301 ~ 27849770 (-) False XLOC_036502
TCONS_00071296 other downstream 478678 26702217 ~ 26707359 (-) False XLOC_036487
TCONS_00071284 other downstream 1339849 25818622 ~ 25846188 (-) False XLOC_036477
TCONS_00071280 other downstream 1424999 25756682 ~ 25761038 (-) False XLOC_036475
TCONS_00071278 other downstream 1430739 25752125 ~ 25755298 (-) False XLOC_036475
TCONS_00071268 other downstream 1520276 25650229 ~ 25665761 (-) False XLOC_036471
TCONS_00071308 other upstream 16882 27203326 ~ 27206090 (-) False XLOC_036495
TCONS_00071309 other upstream 16887 27203331 ~ 27206934 (-) False XLOC_036495
TCONS_00071310 other upstream 16929 27203373 ~ 27205479 (-) False XLOC_036495
TCONS_00071311 other upstream 18802 27205246 ~ 27206559 (-) False XLOC_036495
TCONS_00071312 other upstream 18848 27205292 ~ 27206922 (-) True XLOC_036495

Expression Profile

//