RNA id: AMCG00003516



Basic Information


Item Value
RNA id AMCG00003516
length 279
RNA type mRNA
GC content 0.54
exon number 2
gene id AMCG00003516
representative True

Chromosome Information


Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 7045216 ~ 7047403 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


ATGGCTCTCCAGGGAGGACCCTCCTCCGAGCCACCACTGTGCCCCAAGAAGCAGGCTGCCTCTTTTGGGCCTCTCTCCATCCATGTGGTGGAGGAATGGCGAGTTTGTGTCGGAGTGTCTCTTGCCCGGATGGAACTTTTCCTGTTCTTCACATCTCTGTTACAGCGCTTATCTTTCCATCCTCCTAATGGTGTTGAAGAGAAAGATCTTGATCTGTCCTCTGTTGGGGCACTGTCTGTGGCCCCCCAGCCCCATTGTCTTTGTGCAGTACAGCGTTAA

Function


GO:

id name namespace
GO:0005783 endoplasmic reticulum cellular_component
GO:0031090 organelle membrane cellular_component
GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen molecular_function
GO:0004497 monooxygenase activity molecular_function
GO:0046872 metal ion binding molecular_function

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1177 lncRNA upstream 1058822 5986038 ~ 5986394 (+) True G990
TU1170 lncRNA upstream 1089396 5955604 ~ 5955820 (+) True G983
TU1140 lncRNA upstream 1215471 5829459 ~ 5829745 (+) True G960
TU1088 lncRNA upstream 1486701 5557607 ~ 5558515 (+) True G908
TU1087 lncRNA upstream 1488910 5550745 ~ 5556306 (+) True G907
TU1358 lncRNA downstream 26001 7073404 ~ 7073609 (+) True G1146
TU1403 lncRNA downstream 317541 7364944 ~ 7365477 (+) True G1187
TU1436 lncRNA downstream 442042 7489445 ~ 7489881 (+) True G1218
TU1445 lncRNA downstream 450664 7498067 ~ 7498344 (+) False AMCG00003524
TU1466 lncRNA downstream 476458 7523861 ~ 7750465 (+) True G1241
AMCG00003513 mRNA upstream 4307 7039811 ~ 7040909 (+) True AMCG00003513
AMCG00003507 mRNA upstream 174951 6827929 ~ 6870265 (+) True AMCG00003507
AMCG00003506 mRNA upstream 219506 6818616 ~ 6825710 (+) True AMCG00003506
AMCG00003505 mRNA upstream 308846 6723530 ~ 6736370 (+) True AMCG00003505
AMCG00003501 mRNA upstream 398514 6620811 ~ 6646702 (+) True AMCG00003501
AMCG00003523 mRNA downstream 361142 7408545 ~ 7410129 (+) True AMCG00003523
AMCG00003522 mRNA downstream 375400 7422803 ~ 7438447 (+) True AMCG00003522
AMCG00003529 mRNA downstream 406008 7453411 ~ 7459476 (+) True AMCG00003529
AMCG00003527 mRNA downstream 419518 7466921 ~ 7482206 (+) True AMCG00003527
AMCG00003524 mRNA downstream 450637 7498040 ~ 7504015 (+) True AMCG00003524
TU1202 other upstream 550311 6487692 ~ 6494905 (+) True G1012
TU1569 other downstream 1601722 8649125 ~ 8652404 (+) True AMCG00003534
TU1763 other downstream 2208425 9255828 ~ 9263468 (+) True AMCG00003551
TU1883 other downstream 2730105 9777508 ~ 9780902 (+) True AMCG00003570
TU2334 other downstream 4442782 11490185 ~ 11491443 (+) False AMCG00003606
TU2385 other downstream 4526328 11573731 ~ 11577329 (+) True G1989

Expression Profile