RNA id: TCONS_00009479


Basic Information

Item Value
RNA id TCONS_00009479
length 535
RNA type processed_transcript
GC content 0.49
exon number 3
gene id XLOC_004798
representative True

Chromosome Information

Item Value
chromosome id NC_007123.7
NCBI id CM002896.2
chromosome length 49182954
location 29763546 ~ 29818209 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GATTTAGTGCACTTCTCAAAGGCAGATGCGATCGCACAGTCTCGCTCGGTTCGGCTGGACTGCGTTAGGGCTCATGAACAGTGTTTGGGAAAGTACGGATGCAGCACCAAGTACCGCACTATGAGACAGTGTGTGGCCGGGAGAACCGGTAACTTCAGCATGCTGGCTGAACCAGAGGCGCAGGACGAGTGCAGGAACGCCATAGAGTCGATGAAACAGAGTCCTCTGTATGACTGCAAGTGCAGGAGAGGAATGAAGAAAGAAAAGAACTGCCTGCGCATCTTCTGGAGTATATATCAAAGTTTACAGGCTAATGACTTATTGGAAGACTCGCCATATGAGCCCGTAAACAGCCGTCTGTCTGATATTTTTCGTCTGGCTCCCATCATATCAGAGTAATTCTATGGGGAAAAAATATTGGAAAAGGTGCACCAGTTCTGGCATGTCCCCGCAACCCTGAGTAATAACTCACAGCTGGGCTGTACAGGAGCGAGCAGGATGTTTATGGCCGCTGCCAGTGAAGGTCCAATAAAAA

Function

GO:

id name namespace
GO:0048484 enteric nervous system development biological_process
GO:0007399 nervous system development biological_process
GO:0031225 anchored component of membrane cellular_component
GO:0009897 external side of plasma membrane cellular_component
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0043235 receptor complex cellular_component
GO:0038023 signaling receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-010226-3 Predicted to enable signaling receptor activity. Acts upstream of or within enteric nervous system development. Predicted to be located in plasma membrane. Predicted to be anchored component of membrane. Predicted to be part of receptor complex. Predicted to be active in external side of plasma membrane. Is expressed in nervous system; presumptive enteric nervous system; pronephric duct; and vagal neural crest. Orthologous to human GFRA1 (GDNF family receptor alpha 1).

Ensembl:

ensembl_id ENSDART00000167801

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00010745 lncRNA upstream 390629 29312565 ~ 29373414 (+) False XLOC_004796
TCONS_00009476 lncRNA upstream 390629 29312565 ~ 29373414 (+) True XLOC_004796
TCONS_00009458 lncRNA upstream 817893 28933524 ~ 28946150 (+) False XLOC_004786
TCONS_00010946 lncRNA upstream 817893 28942234 ~ 28946150 (+) False XLOC_004786
TCONS_00010744 lncRNA upstream 1146078 28617701 ~ 28617965 (+) True XLOC_004779
TCONS_00010947 lncRNA downstream 386355 30153615 ~ 30193020 (+) False XLOC_004802
TCONS_00010948 lncRNA downstream 395494 30162754 ~ 30198532 (+) False XLOC_004802
TCONS_00010949 lncRNA downstream 433386 30200646 ~ 30211446 (+) False XLOC_004802
TCONS_00009492 lncRNA downstream 440206 30207466 ~ 30209133 (+) True XLOC_004802
TCONS_00009497 lncRNA downstream 593319 30360579 ~ 30363549 (+) False XLOC_004804
TCONS_00009474 mRNA upstream 493681 29240124 ~ 29270362 (+) False XLOC_004795
TCONS_00009475 mRNA upstream 512579 29240183 ~ 29251464 (+) True XLOC_004795
TCONS_00009473 mRNA upstream 526228 29236274 ~ 29237815 (+) True XLOC_004794
TCONS_00009472 mRNA upstream 552445 29173523 ~ 29211598 (+) True XLOC_004793
TCONS_00009471 mRNA upstream 555526 29131689 ~ 29208517 (+) False XLOC_004793
TCONS_00009483 mRNA downstream 279060 30046320 ~ 30192619 (+) False XLOC_004802
TCONS_00009484 mRNA downstream 279115 30046375 ~ 30129312 (+) False XLOC_004802
TCONS_00009485 mRNA downstream 342438 30109698 ~ 30193020 (+) False XLOC_004802
TCONS_00009486 mRNA downstream 342438 30109698 ~ 30220346 (+) False XLOC_004802
TCONS_00009488 mRNA downstream 401082 30168342 ~ 30204839 (+) False XLOC_004802
TCONS_00009477 other upstream 331852 29432075 ~ 29432191 (+) True XLOC_004797
TCONS_00009467 other upstream 750353 29013573 ~ 29013690 (+) True XLOC_004791
TCONS_00009459 other upstream 818397 28945532 ~ 28945646 (+) True XLOC_004786
TCONS_00009428 other upstream 2529622 27231295 ~ 27234421 (+) False XLOC_004766
TCONS_00009426 other upstream 2543454 27218993 ~ 27220589 (+) True XLOC_004765
TCONS_00009480 other downstream 44584 29811844 ~ 29811960 (+) True XLOC_004799
TCONS_00009481 other downstream 192680 29959940 ~ 29960054 (+) True XLOC_004800
TCONS_00009482 other downstream 203253 29970513 ~ 29970629 (+) True XLOC_004801
TCONS_00009487 other downstream 401070 30168330 ~ 30200769 (+) False XLOC_004802
TCONS_00009491 other downstream 439953 30207213 ~ 30211446 (+) False XLOC_004802

Expression Profile

//