G347198


Basic Information

Item Value
gene id G347198
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000135
NCBI id null
chromosome length 1546597
location 805279 ~ 877916 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU395250
AATCCCTCTAAATCATCACGGGTTTCAGCTTTACCTCAAAGTCCGGCTCCAGAGACGGCCGCGGTCAGACGGAGCTGATGTATTCTCCAACAGCGTTCCTAAACGAGGTCCCGGGATGGTATATGTGGACGGGGATCTTCTTACCTGTGACGGCACTCCTGCTGCTGTTCATCGCTTACCTCAGCTGGAGGATCCGCAAGAAGGAAGAGTTGTTGTAGTAGAGTGTTGTTGTCATGCCGTCATTTTACACCGGACTGCTTCACAAACGAGGGTCAATTCAACACAAAAGATTAACATGACGGCACATGCTAGTGGATGAGTTGAATCAACTCCACAGCAACTACATAAATTTATCCACTAACCATTCAGAAACGTCCAGTTTCATTCTAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU395250 True 392 lncRNA 0.47 2 805279 877916

Neighbor

gene id symbol gene type direction distance location
CI01000135_00791752_00800033 NA coding downstream 4408 790724 ~ 800871 (-)
CI01000135_00707778_00716012 NA coding downstream 89267 706901 ~ 716012 (-)
CI01000135_00696281_00705815 NA coding downstream 98779 696281 ~ 706500 (-)
CI01000135_00679808_00684801 NA coding downstream 120478 679570 ~ 684801 (-)
CI01000135_00623693_00630930 AKIRIN2, CF166 coding downstream 173809 623473 ~ 631470 (-)
CI01000135_00881762_00883731 NA coding upstream 3058 880974 ~ 883731 (-)
CI01000135_00909940_00911418 TMEM200A coding upstream 31842 909758 ~ 911564 (-)
CI01000135_00935305_00937803 L3MBTL3 coding upstream 56558 934474 ~ 939483 (-)
CI01000135_00949536_00968521 NA coding upstream 71620 949536 ~ 968521 (-)
CI01000135_01036648_01040176 LAMA2 coding upstream 158597 1036513 ~ 1040176 (-)
G347194 NA non-coding downstream 80798 724207 ~ 724481 (-)
G347193 NA non-coding downstream 88121 716804 ~ 717158 (-)
G347161 NA non-coding downstream 106909 677545 ~ 698370 (-)
G347162 NA non-coding downstream 119109 685358 ~ 686170 (-)
CI01000135_00524340_00537589 NA non-coding downstream 271096 524149 ~ 538715 (-)
G347219 NA non-coding upstream 1806 879722 ~ 879945 (-)
G347231 NA non-coding upstream 13585 891501 ~ 891784 (-)
G347235 NA non-coding upstream 16492 894408 ~ 894615 (-)
G347242 NA non-coding upstream 22926 900842 ~ 901091 (-)
G347244 NA non-coding upstream 45010 922926 ~ 923309 (-)
G347001 NA other downstream 308868 198316 ~ 496411 (-)
G347279 NA other upstream 269087 1147003 ~ 1216826 (-)
G347296 NA other upstream 454448 1332364 ~ 1366129 (-)

Expression


Co-expression Network