G407562



Basic Information


Item Value
gene id G407562
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 4939691 ~ 4939939 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU468295
GAAAACATGAATTTTTCAAATAGTTAAGAGAGTTAGTTACTTTGCTTCATGACCATGTGGTCCTTTGCAGGTGTCTGAATGATGTCACATCCTGTCACATGATATTGACCGCATGACTTGATCCAAAATGGTCCCTTTATATTGGTTACTCCGAATGACATCAATGAAATTAATTTTTCCAGACATTCTTTCTCATAACAAAGCAATGACTTCTACACATAATTTGAATACCATTTTACACTATGTTGA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU468295 True 249 lncRNA 0.34 1 4939691 4939939

Neighbor


gene id symbol gene type direction distance location
CI01000299_04913779_04927715 NA coding downstream 11976 4913373 ~ 4927715 (-)
CI01000299_04861862_04862244 NA coding downstream 77098 4861577 ~ 4862593 (-)
CI01000299_04741460_04746667 NA coding downstream 193024 4741447 ~ 4746667 (-)
CI01000299_04708767_04714088 RCAN1B coding downstream 225603 4708503 ~ 4714088 (-)
CI01000299_04658984_04668843 ATP1A1A.4, ATP1A1 coding downstream 270669 4658895 ~ 4669022 (-)
CI01000299_05379545_05381902 NA coding upstream 439210 5379149 ~ 5382140 (-)
CI01000299_05419449_05423414 ATP5J coding upstream 479464 5419403 ~ 5423414 (-)
CI01000299_05428160_05443433 APP, APPA coding upstream 487722 5427661 ~ 5443433 (-)
CI01000299_05457285_05462908 NA coding upstream 517168 5456864 ~ 5463491 (-)
CI01000299_05466693_05471714 ADAMTS1 coding upstream 525703 5465642 ~ 5471987 (-)
G407526 NA non-coding downstream 116140 4822041 ~ 4823551 (-)
G407475 NA non-coding downstream 234890 4704124 ~ 4704801 (-)
G407477 NA non-coding downstream 261463 4678018 ~ 4678228 (-)
G407476 NA non-coding downstream 262245 4677110 ~ 4677446 (-)
G407467 NA non-coding downstream 302266 4636610 ~ 4637425 (-)
G407564 NA non-coding upstream 16159 4956098 ~ 4956365 (-)
G407565 NA non-coding upstream 18048 4957987 ~ 4996909 (-)
G407591 NA non-coding upstream 145455 5085394 ~ 5182362 (-)
G407669 NA non-coding upstream 473395 5413334 ~ 5418371 (-)
G407413 NA other downstream 388970 4475994 ~ 4550721 (-)
G405053 NA other downstream 2921641 2017687 ~ 2018050 (-)
G404976 NA other downstream 3058703 1855639 ~ 1880988 (-)
G407805 NA other upstream 887897 5835889 ~ 5835989 (-)
CI01000299_06526127_06532048 CEP97 other upstream 1592062 6526127 ~ 6532048 (-)

Expression



Co-expression Network