G679072


Basic Information

Item Value
gene id G679072
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 1778590 ~ 1779698 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU799763
CCTTCTGGCTGTCCAGCTGTTCACAGGCCCGTTGGCTCTTCCACAGGTCGCTCTGTGTTTGACGCTCTTCTCTTTCGGTTCTCTTACGCACTCTAAAATCCTCAAGTGATTTCTTCTCCACATGTTGTTTCATTTGCACTTTTCTCCGGTAATTCTGAAGTTCCTCATCTGCTTTCCTCTTCTTAAGTTCTTCCATTCCAATGCCGCCTCTGTCTGTTTTGATGTTGAGAGGAACCGGCTCAACCCGCCCAGCACCTGCAGCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU799763 True 263 lncRNA 0.49 3 1778590 1779698

Neighbor

gene id symbol gene type direction distance location
CI01180000_01747067_01755038 GPR137B coding upstream 23333 1747067 ~ 1755257 (+)
CI01180000_01576739_01578505 GNG4 coding upstream 199184 1576739 ~ 1579406 (+)
CI01180000_01542059_01545609 GGPS1 coding upstream 232510 1542059 ~ 1546080 (+)
CI01180000_01492241_01493781 NA coding upstream 284144 1491671 ~ 1494446 (+)
CI01180000_01380859_01385445 NA coding upstream 392807 1380701 ~ 1385783 (+)
CI01180000_01828938_01830221 DNAJC12 coding downstream 49240 1828938 ~ 1830814 (+)
CI01180000_01832263_01834405 COX5B.2, COX5B2, COX5B coding downstream 52315 1832013 ~ 1834999 (+)
CI01180000_01865632_01870994 NA coding downstream 85811 1865509 ~ 1871089 (+)
CI01180000_01915282_01926129 NA coding downstream 135194 1914892 ~ 1926269 (+)
CI01180000_01942458_01949580 NA coding downstream 162429 1942127 ~ 1950647 (+)
G679052 NA non-coding upstream 1465 1776710 ~ 1777125 (+)
G679069 NA non-coding upstream 13052 1765310 ~ 1765538 (+)
G679064 NA non-coding upstream 42829 1735417 ~ 1735761 (+)
G678942 NA non-coding upstream 44873 1727161 ~ 1733717 (+)
G678945 NA non-coding upstream 70971 1706515 ~ 1707619 (+)
G679077 NA non-coding downstream 23707 1803405 ~ 1808055 (+)
G679080 NA non-coding downstream 29184 1808882 ~ 1809140 (+)
G679160 NA non-coding downstream 251040 2030738 ~ 2031031 (+)
G679165 NA non-coding downstream 271829 2051527 ~ 2061011 (+)
G679202 NA non-coding downstream 318843 2098541 ~ 2098808 (+)
G678946 NA other upstream 222439 1518353 ~ 1612547 (+)
G678637 NA other upstream 622918 1149551 ~ 1155672 (+)
G678751 NA other upstream 712499 1059843 ~ 1066091 (+)
G678440 NA other upstream 1626938 147934 ~ 151652 (+)
G679076 NA other downstream 15472 1795170 ~ 1799433 (+)
G679324 NA other downstream 609169 2388867 ~ 2397360 (+)
CI01180000_02690045_02691641 NKX6-2, NKX6-2.L, NKX6.2 other downstream 910064 2689271 ~ 2693221 (+)
CI01180000_03571292_03571611 GNG2.L, GBG2, GNG2 other downstream 1773579 3569165 ~ 3573135 (+)
G680736 NA other downstream 1985993 3765691 ~ 3784441 (+)

Expression


Co-expression Network