XLOC_026532 (ighv13-2)


Basic Information

Item Value
gene id XLOC_026532
gene name ighv13-2
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 34031577 ~ 34032019 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00051706
ATGAGTCAAACTCTTCTCCTTTTATTTGCCTTTTTTCCATATGTTTCTGGCATCTCCCTGACCTCATCCCCTGCACAGATTAAAGCTGCTGGTCAGTCAGTCAGGTTGTCCTGTCAAATTTCTGGATACGCTCTCACAGATTATGGCACAGCTTGGATCAGACATCCTCCTGGAAAAGCCATGGAATGGATCGGGATTATATGGGGTAGAGGATCAATAGACTCTGGGAACTCCTTCAAGAGTCGCTTCACTATTTCCAGAGACACAAGGAAAAATGAGCTGTACTTAGACATCAGCAGCCTGCAGACTGAGGACACAGCTGTGTATTATTGTGCAAAGACAGC

Function

symbol description
ighv13-2 Predicted to enable antigen binding activity and immunoglobulin receptor binding activity. Predicted to be involved in several processes, including activation of immune response; defense response to other organism; and phagocytosis. Predicted to be part of immunoglobulin complex, circulating. Predicted to be active in external side of plasma membrane.

GO:

id name namespace
GO:0045087 innate immune response biological_process
GO:0050871 positive regulation of B cell activation biological_process
GO:0006910 phagocytosis, recognition biological_process
GO:0006911 phagocytosis, engulfment biological_process
GO:0042742 defense response to bacterium biological_process
GO:0006958 complement activation, classical pathway biological_process
GO:0050853 B cell receptor signaling pathway biological_process
GO:0009897 external side of plasma membrane cellular_component
GO:0042571 immunoglobulin complex, circulating cellular_component
GO:0034987 immunoglobulin receptor binding molecular_function
GO:0003823 antigen binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040514-41 Predicted to enable antigen binding activity and immunoglobulin receptor binding activity. Predicted to be involved in several processes, including activation of immune response; defense response to other organism; and phagocytosis. Predicted to be part of immunoglobulin complex, circulating. Predicted to be active in external side of plasma membrane.

Ensembl:

ensembl_id ENSDARG00000096372

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00051706 True 344 mRNA 0.45 2 34031577 34032019

Neighbor

gene id symbol gene type direction distance location
XLOC_026531 ighv2-3 coding downstream 642 34030460 ~ 34030935 (-)
XLOC_026530 ighv1-3 coding downstream 2683 34028457 ~ 34028894 (-)
XLOC_026529 BX649502.7 coding downstream 7964 34023165 ~ 34023613 (-)
XLOC_026528 si:dkey-204f11.51 coding downstream 13701 34017838 ~ 34017876 (-)
XLOC_026527 BX649502.12 coding downstream 16044 34015518 ~ 34015533 (-)
XLOC_026533 ighv11-2 coding upstream 2029 34034048 ~ 34034498 (-)
XLOC_026534 BX649502.8 coding upstream 3173 34035192 ~ 34035631 (-)
XLOC_026535 ighv9-4 coding upstream 4600 34036619 ~ 34042028 (-)
XLOC_026536 ighv9-3 coding upstream 6734 34038753 ~ 34039242 (-)
XLOC_026537 ighv8-4 coding upstream 7611 34039630 ~ 34040063 (-)
XLOC_026513 BX510335.1 non-coding downstream 82789 33948669 ~ 33948788 (-)
XLOC_026511 NA non-coding downstream 112382 33918566 ~ 33919195 (-)
XLOC_026509 CU695077.1 non-coding downstream 340823 33681518 ~ 33690754 (-)
XLOC_026505 CR396582.3 non-coding downstream 607249 33424192 ~ 33424328 (-)
XLOC_026538 BX649502.6 non-coding upstream 15160 34047179 ~ 34047616 (-)
XLOC_026539 BX649502.4 non-coding upstream 16186 34048205 ~ 34048653 (-)
XLOC_026544 BX649502.10 non-coding upstream 26660 34058679 ~ 34058717 (-)
XLOC_026547 BX649502.5 non-coding upstream 31936 34063955 ~ 34064936 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) G1186082 NA non-coding NC_048577.1 CM023231.2 51837324 ~ 51850988 (-)