RNA id: TCONS_00051706


Basic Information

Item Value
RNA id TCONS_00051706
length 344
RNA type mRNA
GC content 0.45
exon number 2
gene id XLOC_026532
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 34031577 ~ 34032019 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGAGTCAAACTCTTCTCCTTTTATTTGCCTTTTTTCCATATGTTTCTGGCATCTCCCTGACCTCATCCCCTGCACAGATTAAAGCTGCTGGTCAGTCAGTCAGGTTGTCCTGTCAAATTTCTGGATACGCTCTCACAGATTATGGCACAGCTTGGATCAGACATCCTCCTGGAAAAGCCATGGAATGGATCGGGATTATATGGGGTAGAGGATCAATAGACTCTGGGAACTCCTTCAAGAGTCGCTTCACTATTTCCAGAGACACAAGGAAAAATGAGCTGTACTTAGACATCAGCAGCCTGCAGACTGAGGACACAGCTGTGTATTATTGTGCAAAGACAGC

Function

GO:

id name namespace
GO:0045087 innate immune response biological_process
GO:0050871 positive regulation of B cell activation biological_process
GO:0006910 phagocytosis, recognition biological_process
GO:0006911 phagocytosis, engulfment biological_process
GO:0042742 defense response to bacterium biological_process
GO:0006958 complement activation, classical pathway biological_process
GO:0050853 B cell receptor signaling pathway biological_process
GO:0009897 external side of plasma membrane cellular_component
GO:0042571 immunoglobulin complex, circulating cellular_component
GO:0034987 immunoglobulin receptor binding molecular_function
GO:0003823 antigen binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040514-41 Predicted to enable antigen binding activity and immunoglobulin receptor binding activity. Predicted to be involved in several processes, including activation of immune response; defense response to other organism; and phagocytosis. Predicted to be part of immunoglobulin complex, circulating. Predicted to be active in external side of plasma membrane.

Ensembl:

ensembl_id ENSDART00000151779

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00051677 lncRNA downstream 92756 33936453 ~ 33938821 (-) True XLOC_026512
TCONS_00051675 lncRNA downstream 96139 33922620 ~ 33935438 (-) False XLOC_026512
TCONS_00053065 lncRNA downstream 112382 33918566 ~ 33919195 (-) True XLOC_026511
TCONS_00051667 lncRNA downstream 340823 33681518 ~ 33690754 (-) True XLOC_026509
TCONS_00051659 lncRNA downstream 593845 33435754 ~ 33437732 (-) True XLOC_026506
TCONS_00053066 lncRNA upstream 107618 34139637 ~ 34141181 (-) True XLOC_026572
TCONS_00051762 lncRNA upstream 147788 34179807 ~ 34180432 (-) False XLOC_026573
TCONS_00051763 lncRNA upstream 147788 34179807 ~ 34180451 (-) True XLOC_026573
TCONS_00051771 lncRNA upstream 438135 34470154 ~ 34477363 (-) False XLOC_026575
TCONS_00051773 lncRNA upstream 493923 34525942 ~ 34546406 (-) False XLOC_026575
TCONS_00051705 mRNA downstream 642 34030460 ~ 34030935 (-) True XLOC_026531
TCONS_00051704 mRNA downstream 2683 34028457 ~ 34028894 (-) True XLOC_026530
TCONS_00051682 mRNA downstream 4399 33965579 ~ 34027178 (-) False XLOC_026515
TCONS_00051703 mRNA downstream 4399 34026706 ~ 34027178 (-) False XLOC_026515
TCONS_00051684 mRNA downstream 9501 33965753 ~ 34022076 (-) False XLOC_026515
TCONS_00051707 mRNA upstream 2029 34034048 ~ 34034498 (-) True XLOC_026533
TCONS_00051709 mRNA upstream 4600 34036619 ~ 34041878 (-) False XLOC_026535
TCONS_00051710 mRNA upstream 4600 34036619 ~ 34042028 (-) False XLOC_026535
TCONS_00051711 mRNA upstream 4608 34036627 ~ 34037064 (-) False XLOC_026535
TCONS_00051713 mRNA upstream 6734 34038753 ~ 34039242 (-) True XLOC_026536
TCONS_00051702 other downstream 7964 34023165 ~ 34023613 (-) True XLOC_026529
TCONS_00051678 other downstream 82789 33948669 ~ 33948788 (-) True XLOC_026513
TCONS_00051656 other downstream 607249 33424192 ~ 33424328 (-) True XLOC_026505
TCONS_00051635 other downstream 1058043 32972974 ~ 32973534 (-) True XLOC_026495
TCONS_00051585 other downstream 1844192 32186134 ~ 32187385 (-) False XLOC_026474
TCONS_00051708 other upstream 3173 34035192 ~ 34035631 (-) True XLOC_026534
TCONS_00051712 other upstream 5462 34037481 ~ 34037881 (-) True XLOC_026535
TCONS_00051715 other upstream 15160 34047179 ~ 34047616 (-) True XLOC_026538
TCONS_00051716 other upstream 16186 34048205 ~ 34048653 (-) True XLOC_026539
TCONS_00051722 other upstream 26660 34058679 ~ 34058717 (-) True XLOC_026544

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
rainbow trout (Oncorhynchus mykiss) TU1352618 True 508 lncRNA 0.43 2 NC_048577.1 51837324 ~ 51850988 (-)